Incidental Mutation 'R5957:Serpinb9b'
ID471240
Institutional Source Beutler Lab
Gene Symbol Serpinb9b
Ensembl Gene ENSMUSG00000021403
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9b
Synonyms1600019A21Rik, Spi10, ovalbumin, SPI-CI, R86
MMRRC Submission 043246-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5957 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location33027416-33041884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33039848 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 341 (L341P)
Ref Sequence ENSEMBL: ENSMUSP00000006392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006392]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006392
AA Change: L341P

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006392
Gene: ENSMUSG00000021403
AA Change: L341P

DomainStartEndE-ValueType
SERPIN 13 377 7.86e-164 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220566
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,161 T1704A probably benign Het
Adgrg7 T A 16: 56,773,427 N142I probably damaging Het
Aldh18a1 A T 19: 40,570,537 Y286* probably null Het
Armc4 T C 18: 7,285,706 E219G probably benign Het
Arpp21 T C 9: 112,185,686 T17A probably benign Het
Atp5s T C 12: 69,743,784 V185A probably benign Het
Bnip2 T C 9: 69,999,238 I147T probably damaging Het
Ccr8 T C 9: 120,093,827 Y3H probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Cul7 G A 17: 46,657,757 G553S probably damaging Het
Cyp21a1 A G 17: 34,803,176 I206T probably benign Het
Dennd4b A G 3: 90,270,965 D488G probably damaging Het
Dip2b T C 15: 100,209,694 L1195P probably benign Het
Dock5 T A 14: 67,857,994 H77L probably benign Het
Fbxw13 C T 9: 109,192,666 probably null Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gbf1 G T 19: 46,246,221 probably null Het
Gm12794 T C 4: 101,941,701 F290L probably benign Het
Gm4846 T C 1: 166,486,953 I374V probably benign Het
Gsk3b C A 16: 38,193,953 P258T probably damaging Het
Igsf5 T C 16: 96,364,049 V8A probably benign Het
Il22 T A 10: 118,205,166 L59Q probably damaging Het
Ildr1 T C 16: 36,725,534 *517Q probably null Het
Iqca T A 1: 90,080,948 D450V probably damaging Het
Itga5 T C 15: 103,351,429 D647G probably benign Het
Myh7 T G 14: 54,989,078 N408T probably damaging Het
Mylk3 T C 8: 85,328,637 M564V probably damaging Het
Nsd2 T A 5: 33,855,603 M407K probably damaging Het
Oprd1 C T 4: 132,144,163 V75I probably benign Het
Poli G A 18: 70,517,440 H310Y probably benign Het
Ptch1 C T 13: 63,525,115 R755H probably damaging Het
Pygl A T 12: 70,199,720 M351K probably damaging Het
Slc47a1 A G 11: 61,344,342 V555A probably benign Het
Slc8a2 C A 7: 16,145,284 T565K possibly damaging Het
Snx14 T C 9: 88,403,274 I446V possibly damaging Het
Syde1 T C 10: 78,590,117 Y72C probably damaging Het
Trim37 C T 11: 87,145,551 R138C probably damaging Het
Tubgcp5 T A 7: 55,814,962 S530R probably benign Het
Vps13c T C 9: 67,954,971 S2957P probably damaging Het
Wdr41 T C 13: 94,997,187 probably null Het
Zyg11b T C 4: 108,245,013 K504E probably damaging Het
Other mutations in Serpinb9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Serpinb9b APN 13 33035625 missense probably benign 0.00
IGL00518:Serpinb9b APN 13 33039570 missense probably benign 0.17
IGL01939:Serpinb9b APN 13 33039665 missense probably damaging 0.99
IGL02472:Serpinb9b APN 13 33039970 utr 3 prime probably benign
IGL02632:Serpinb9b APN 13 33039823 missense probably benign 0.01
R0255:Serpinb9b UTSW 13 33038020 missense probably benign
R0667:Serpinb9b UTSW 13 33032926 nonsense probably null
R0699:Serpinb9b UTSW 13 33033566 missense probably benign 0.00
R0703:Serpinb9b UTSW 13 33032981 missense probably benign 0.29
R1605:Serpinb9b UTSW 13 33038129 critical splice donor site probably null
R1623:Serpinb9b UTSW 13 33029565 missense possibly damaging 0.61
R1815:Serpinb9b UTSW 13 33039904 missense probably damaging 1.00
R1920:Serpinb9b UTSW 13 33039548 critical splice acceptor site probably null
R1987:Serpinb9b UTSW 13 33029559 missense probably benign 0.07
R1988:Serpinb9b UTSW 13 33029559 missense probably benign 0.07
R3035:Serpinb9b UTSW 13 33029546 missense possibly damaging 0.81
R3683:Serpinb9b UTSW 13 33029598 missense probably damaging 0.98
R3758:Serpinb9b UTSW 13 33035588 missense probably damaging 1.00
R4677:Serpinb9b UTSW 13 33039823 missense probably damaging 0.97
R5412:Serpinb9b UTSW 13 33029513 missense probably benign 0.00
R5481:Serpinb9b UTSW 13 33038093 missense possibly damaging 0.93
R5672:Serpinb9b UTSW 13 33039599 missense probably benign 0.01
R6797:Serpinb9b UTSW 13 33029484 missense possibly damaging 0.60
R7586:Serpinb9b UTSW 13 33039760 missense probably damaging 1.00
R8115:Serpinb9b UTSW 13 33035548 missense probably null 0.94
R8309:Serpinb9b UTSW 13 33039571 missense probably damaging 1.00
X0019:Serpinb9b UTSW 13 33035531 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGGTCCACTGAGGTTAAGG -3'
(R):5'- ATTCTCACGGAGCTGTAGGAG -3'

Sequencing Primer
(F):5'- AGATGAAATCTGTGCTTCAGTGC -3'
(R):5'- CACGGAGCTGTAGGAGTGGTG -3'
Posted On2017-03-31