Incidental Mutation 'R5957:Myh7'
ID471242
Institutional Source Beutler Lab
Gene Symbol Myh7
Ensembl Gene ENSMUSG00000053093
Gene Namemyosin, heavy polypeptide 7, cardiac muscle, beta
SynonymsMyhcb, Myhc-b, MyHC-I, B-MHC, MYH-beta/slow, beta-MHC
MMRRC Submission 043246-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #R5957 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location54970684-54994626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 54989078 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 408 (N408T)
Ref Sequence ENSEMBL: ENSMUSP00000126840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102803] [ENSMUST00000153783] [ENSMUST00000168485] [ENSMUST00000226424] [ENSMUST00000227518] [ENSMUST00000228837]
Predicted Effect probably damaging
Transcript: ENSMUST00000102803
AA Change: N408T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099867
Gene: ENSMUSG00000053093
AA Change: N408T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 73 3.8e-16 PFAM
MYSc 79 779 N/A SMART
IQ 780 802 2.5e-2 SMART
Pfam:Myosin_tail_1 843 1924 5.6e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149852
Predicted Effect probably benign
Transcript: ENSMUST00000153783
SMART Domains Protein: ENSMUSP00000116595
Gene: ENSMUSG00000053093

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 61 8.8e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168485
AA Change: N408T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126840
Gene: ENSMUSG00000053093
AA Change: N408T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 75 1.6e-17 PFAM
MYSc 79 779 N/A SMART
IQ 780 802 2.5e-2 SMART
PDB:2FXO|D 838 963 6e-53 PDB
Pfam:Myosin_tail_1 1068 1926 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226424
Predicted Effect probably benign
Transcript: ENSMUST00000227518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228715
Predicted Effect probably benign
Transcript: ENSMUST00000228837
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Muscle myosin is a hexameric protein containing 2 heavy chain subunits, 2 alkali light chain subunits, and 2 regulatory light chain subunits. This gene encodes the beta (or slow) heavy chain subunit of cardiac myosin. It is expressed predominantly in normal human ventricle. It is also expressed in skeletal muscle tissues rich in slow-twitch type I muscle fibers. Changes in the relative abundance of this protein and the alpha (or fast) heavy subunit of cardiac myosin correlate with the contractile velocity of cardiac muscle. Its expression is also altered during thyroid hormone depletion and hemodynamic overloading. Mutations in this gene are associated with familial hypertrophic cardiomyopathy, myosin storage myopathy, dilated cardiomyopathy, and Laing early-onset distal myopathy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,161 T1704A probably benign Het
Adgrg7 T A 16: 56,773,427 N142I probably damaging Het
Aldh18a1 A T 19: 40,570,537 Y286* probably null Het
Armc4 T C 18: 7,285,706 E219G probably benign Het
Arpp21 T C 9: 112,185,686 T17A probably benign Het
Atp5s T C 12: 69,743,784 V185A probably benign Het
Bnip2 T C 9: 69,999,238 I147T probably damaging Het
Ccr8 T C 9: 120,093,827 Y3H probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Cul7 G A 17: 46,657,757 G553S probably damaging Het
Cyp21a1 A G 17: 34,803,176 I206T probably benign Het
Dennd4b A G 3: 90,270,965 D488G probably damaging Het
Dip2b T C 15: 100,209,694 L1195P probably benign Het
Dock5 T A 14: 67,857,994 H77L probably benign Het
Fbxw13 C T 9: 109,192,666 probably null Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gbf1 G T 19: 46,246,221 probably null Het
Gm12794 T C 4: 101,941,701 F290L probably benign Het
Gm4846 T C 1: 166,486,953 I374V probably benign Het
Gsk3b C A 16: 38,193,953 P258T probably damaging Het
Igsf5 T C 16: 96,364,049 V8A probably benign Het
Il22 T A 10: 118,205,166 L59Q probably damaging Het
Ildr1 T C 16: 36,725,534 *517Q probably null Het
Iqca T A 1: 90,080,948 D450V probably damaging Het
Itga5 T C 15: 103,351,429 D647G probably benign Het
Mylk3 T C 8: 85,328,637 M564V probably damaging Het
Nsd2 T A 5: 33,855,603 M407K probably damaging Het
Oprd1 C T 4: 132,144,163 V75I probably benign Het
Poli G A 18: 70,517,440 H310Y probably benign Het
Ptch1 C T 13: 63,525,115 R755H probably damaging Het
Pygl A T 12: 70,199,720 M351K probably damaging Het
Serpinb9b T C 13: 33,039,848 L341P possibly damaging Het
Slc47a1 A G 11: 61,344,342 V555A probably benign Het
Slc8a2 C A 7: 16,145,284 T565K possibly damaging Het
Snx14 T C 9: 88,403,274 I446V possibly damaging Het
Syde1 T C 10: 78,590,117 Y72C probably damaging Het
Trim37 C T 11: 87,145,551 R138C probably damaging Het
Tubgcp5 T A 7: 55,814,962 S530R probably benign Het
Vps13c T C 9: 67,954,971 S2957P probably damaging Het
Wdr41 T C 13: 94,997,187 probably null Het
Zyg11b T C 4: 108,245,013 K504E probably damaging Het
Other mutations in Myh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Myh7 APN 14 54987388 missense probably damaging 1.00
IGL01025:Myh7 APN 14 54979537 missense probably damaging 1.00
IGL01092:Myh7 APN 14 54971632 missense possibly damaging 0.91
IGL01384:Myh7 APN 14 54971459 missense probably damaging 1.00
IGL01457:Myh7 APN 14 54988879 missense possibly damaging 0.66
IGL01671:Myh7 APN 14 54972924 missense probably damaging 1.00
IGL01923:Myh7 APN 14 54985459 critical splice donor site probably null
IGL02183:Myh7 APN 14 54974731 missense probably benign
IGL02379:Myh7 APN 14 54979468 missense probably damaging 1.00
IGL02884:Myh7 APN 14 54992819 missense probably benign 0.26
IGL02898:Myh7 APN 14 54983740 missense probably damaging 1.00
IGL03027:Myh7 APN 14 54983550 missense probably damaging 1.00
IGL03061:Myh7 APN 14 54991204 unclassified probably benign
IGL03145:Myh7 APN 14 54983345 missense probably damaging 1.00
IGL03250:Myh7 APN 14 54992247 missense probably damaging 1.00
IGL03394:Myh7 APN 14 54975361 missense probably damaging 1.00
BB008:Myh7 UTSW 14 54983662 missense possibly damaging 0.79
BB018:Myh7 UTSW 14 54983662 missense possibly damaging 0.79
R0019:Myh7 UTSW 14 54983734 missense possibly damaging 0.91
R0030:Myh7 UTSW 14 54991970 missense probably benign 0.00
R0183:Myh7 UTSW 14 54978876 missense probably benign 0.02
R0230:Myh7 UTSW 14 54973933 missense probably benign 0.03
R0295:Myh7 UTSW 14 54984821 splice site probably benign
R0423:Myh7 UTSW 14 54979189 missense probably benign 0.06
R0537:Myh7 UTSW 14 54990799 missense possibly damaging 0.81
R0541:Myh7 UTSW 14 54974701 missense probably benign
R0581:Myh7 UTSW 14 54985496 missense probably benign 0.02
R0786:Myh7 UTSW 14 54992873 start codon destroyed probably null
R0866:Myh7 UTSW 14 54973139 missense probably benign
R1068:Myh7 UTSW 14 54987319 missense possibly damaging 0.93
R1075:Myh7 UTSW 14 54987403 missense probably benign
R1124:Myh7 UTSW 14 54973870 missense possibly damaging 0.78
R1140:Myh7 UTSW 14 54972882 missense probably damaging 1.00
R1260:Myh7 UTSW 14 54988451 missense probably benign 0.00
R1653:Myh7 UTSW 14 54990789 missense probably benign 0.00
R1677:Myh7 UTSW 14 54987516 missense probably benign 0.17
R1760:Myh7 UTSW 14 54972713 missense probably damaging 1.00
R1838:Myh7 UTSW 14 54973180 missense possibly damaging 0.91
R1839:Myh7 UTSW 14 54973180 missense possibly damaging 0.91
R2483:Myh7 UTSW 14 54973381 missense probably damaging 0.99
R2566:Myh7 UTSW 14 54983242 missense probably damaging 1.00
R3623:Myh7 UTSW 14 54973381 missense probably damaging 0.99
R3916:Myh7 UTSW 14 54974046 missense probably damaging 0.97
R4236:Myh7 UTSW 14 54991118 missense probably benign 0.34
R4471:Myh7 UTSW 14 54991854 nonsense probably null
R4700:Myh7 UTSW 14 54988321 missense possibly damaging 0.85
R4805:Myh7 UTSW 14 54985133 missense probably benign 0.27
R4880:Myh7 UTSW 14 54978588 missense probably benign 0.18
R4975:Myh7 UTSW 14 54971671 missense probably damaging 1.00
R4982:Myh7 UTSW 14 54972767 missense probably damaging 0.98
R5004:Myh7 UTSW 14 54971683 missense probably damaging 0.99
R5107:Myh7 UTSW 14 54986424 intron probably benign
R5124:Myh7 UTSW 14 54985742 nonsense probably null
R5256:Myh7 UTSW 14 54979508 missense probably damaging 1.00
R5335:Myh7 UTSW 14 54986563 intron probably benign
R5581:Myh7 UTSW 14 54978954 missense probably benign 0.00
R5861:Myh7 UTSW 14 54988890 missense possibly damaging 0.89
R6027:Myh7 UTSW 14 54970802 missense probably benign 0.01
R6184:Myh7 UTSW 14 54988858 missense probably damaging 1.00
R6232:Myh7 UTSW 14 54989296 missense probably benign 0.00
R6268:Myh7 UTSW 14 54989284 missense probably benign 0.00
R6274:Myh7 UTSW 14 54979486 missense probably damaging 0.97
R6345:Myh7 UTSW 14 54983692 missense probably damaging 1.00
R6383:Myh7 UTSW 14 54988894 missense probably benign 0.00
R6641:Myh7 UTSW 14 54982280 missense probably benign 0.37
R6755:Myh7 UTSW 14 54992313 missense possibly damaging 0.71
R6952:Myh7 UTSW 14 54991740 missense probably damaging 1.00
R7025:Myh7 UTSW 14 54974644 nonsense probably null
R7201:Myh7 UTSW 14 54990945 missense possibly damaging 0.58
R7257:Myh7 UTSW 14 54972490 splice site probably null
R7296:Myh7 UTSW 14 54990025 missense probably benign 0.05
R7709:Myh7 UTSW 14 54988801 missense probably damaging 1.00
R7710:Myh7 UTSW 14 54988801 missense probably damaging 1.00
R7711:Myh7 UTSW 14 54988801 missense probably damaging 1.00
R7712:Myh7 UTSW 14 54988801 missense probably damaging 1.00
R7817:Myh7 UTSW 14 54988801 missense probably damaging 1.00
R7858:Myh7 UTSW 14 54990043 missense probably benign 0.09
R7869:Myh7 UTSW 14 54989073 missense probably damaging 0.99
R7870:Myh7 UTSW 14 54988801 missense probably damaging 1.00
R7887:Myh7 UTSW 14 54983662 missense possibly damaging 0.79
R7931:Myh7 UTSW 14 54983662 missense possibly damaging 0.79
R7936:Myh7 UTSW 14 54979463 missense possibly damaging 0.93
R8056:Myh7 UTSW 14 54973319 nonsense probably null
R8061:Myh7 UTSW 14 54990941 missense probably benign
R8101:Myh7 UTSW 14 54973319 nonsense probably null
R8202:Myh7 UTSW 14 54990040 missense probably benign
R8504:Myh7 UTSW 14 54990329 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTCCAGGGTTGCATTGATG -3'
(R):5'- AAGAAAGCCGTGGAGTCACC -3'

Sequencing Primer
(F):5'- ATTGATGCGTGTCACCATCCAG -3'
(R):5'- TCACCGAGGGCCATGTCTG -3'
Posted On2017-03-31