Incidental Mutation 'R5957:Fmnl3'
ID471244
Institutional Source Beutler Lab
Gene Symbol Fmnl3
Ensembl Gene ENSMUSG00000023008
Gene Nameformin-like 3
SynonymsWbp3, 2700073B04Rik
MMRRC Submission 043246-MU
Accession Numbers

Genbank: NM_011711; MGI: 109569  

Is this an essential gene? Possibly essential (E-score: 0.688) question?
Stock #R5957 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location99317225-99370482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99325910 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 302 (R302W)
Ref Sequence ENSEMBL: ENSMUSP00000085566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081224] [ENSMUST00000088233] [ENSMUST00000120633]
Predicted Effect probably damaging
Transcript: ENSMUST00000081224
AA Change: R251W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079984
Gene: ENSMUSG00000023008
AA Change: R251W

DomainStartEndE-ValueType
Drf_GBD 26 227 2.99e-88 SMART
Drf_FH3 230 421 6.1e-71 SMART
low complexity region 448 497 N/A INTRINSIC
FH2 510 944 9.85e-141 SMART
low complexity region 960 975 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088233
AA Change: R302W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085566
Gene: ENSMUSG00000023008
AA Change: R302W

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120633
AA Change: R302W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113094
Gene: ENSMUSG00000023008
AA Change: R302W

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
low complexity region 1011 1026 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140368
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a formin homology 2 domain and has high sequence identity to the mouse Wbp3 protein. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,161 T1704A probably benign Het
Adgrg7 T A 16: 56,773,427 N142I probably damaging Het
Aldh18a1 A T 19: 40,570,537 Y286* probably null Het
Armc4 T C 18: 7,285,706 E219G probably benign Het
Arpp21 T C 9: 112,185,686 T17A probably benign Het
Atp5s T C 12: 69,743,784 V185A probably benign Het
Bnip2 T C 9: 69,999,238 I147T probably damaging Het
Ccr8 T C 9: 120,093,827 Y3H probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Cul7 G A 17: 46,657,757 G553S probably damaging Het
Cyp21a1 A G 17: 34,803,176 I206T probably benign Het
Dennd4b A G 3: 90,270,965 D488G probably damaging Het
Dip2b T C 15: 100,209,694 L1195P probably benign Het
Dock5 T A 14: 67,857,994 H77L probably benign Het
Fbxw13 C T 9: 109,192,666 probably null Het
Gbf1 G T 19: 46,246,221 probably null Het
Gm12794 T C 4: 101,941,701 F290L probably benign Het
Gm4846 T C 1: 166,486,953 I374V probably benign Het
Gsk3b C A 16: 38,193,953 P258T probably damaging Het
Igsf5 T C 16: 96,364,049 V8A probably benign Het
Il22 T A 10: 118,205,166 L59Q probably damaging Het
Ildr1 T C 16: 36,725,534 *517Q probably null Het
Iqca T A 1: 90,080,948 D450V probably damaging Het
Itga5 T C 15: 103,351,429 D647G probably benign Het
Myh7 T G 14: 54,989,078 N408T probably damaging Het
Mylk3 T C 8: 85,328,637 M564V probably damaging Het
Nsd2 T A 5: 33,855,603 M407K probably damaging Het
Oprd1 C T 4: 132,144,163 V75I probably benign Het
Poli G A 18: 70,517,440 H310Y probably benign Het
Ptch1 C T 13: 63,525,115 R755H probably damaging Het
Pygl A T 12: 70,199,720 M351K probably damaging Het
Serpinb9b T C 13: 33,039,848 L341P possibly damaging Het
Slc47a1 A G 11: 61,344,342 V555A probably benign Het
Slc8a2 C A 7: 16,145,284 T565K possibly damaging Het
Snx14 T C 9: 88,403,274 I446V possibly damaging Het
Syde1 T C 10: 78,590,117 Y72C probably damaging Het
Trim37 C T 11: 87,145,551 R138C probably damaging Het
Tubgcp5 T A 7: 55,814,962 S530R probably benign Het
Vps13c T C 9: 67,954,971 S2957P probably damaging Het
Wdr41 T C 13: 94,997,187 probably null Het
Zyg11b T C 4: 108,245,013 K504E probably damaging Het
Other mutations in Fmnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Fmnl3 APN 15 99322670 missense probably damaging 1.00
IGL00672:Fmnl3 APN 15 99325681 missense probably damaging 1.00
IGL00727:Fmnl3 APN 15 99322670 missense probably damaging 1.00
IGL00754:Fmnl3 APN 15 99322670 missense probably damaging 1.00
IGL00927:Fmnl3 APN 15 99337628 critical splice donor site probably null
IGL02376:Fmnl3 APN 15 99318963 missense possibly damaging 0.51
IGL02607:Fmnl3 APN 15 99324772 missense probably damaging 1.00
IGL03323:Fmnl3 APN 15 99321281 missense probably damaging 1.00
C9142:Fmnl3 UTSW 15 99337627 splice site probably null
PIT4280001:Fmnl3 UTSW 15 99321253 critical splice donor site probably null
R0003:Fmnl3 UTSW 15 99321132 missense probably damaging 0.99
R0003:Fmnl3 UTSW 15 99321132 missense probably damaging 0.99
R0116:Fmnl3 UTSW 15 99322738 splice site probably benign
R0117:Fmnl3 UTSW 15 99322738 splice site probably benign
R0137:Fmnl3 UTSW 15 99322738 splice site probably benign
R0138:Fmnl3 UTSW 15 99322738 splice site probably benign
R0701:Fmnl3 UTSW 15 99321307 missense probably damaging 0.99
R2338:Fmnl3 UTSW 15 99370227 missense probably benign 0.01
R3729:Fmnl3 UTSW 15 99321864 missense probably damaging 0.99
R4707:Fmnl3 UTSW 15 99323481 missense probably benign 0.00
R5346:Fmnl3 UTSW 15 99331990 missense probably damaging 1.00
R5655:Fmnl3 UTSW 15 99321862 missense probably damaging 0.99
R5916:Fmnl3 UTSW 15 99321828 missense probably damaging 0.99
R5951:Fmnl3 UTSW 15 99325910 missense probably damaging 1.00
R5954:Fmnl3 UTSW 15 99325910 missense probably damaging 1.00
R6334:Fmnl3 UTSW 15 99337653 missense probably damaging 1.00
R6891:Fmnl3 UTSW 15 99325873 missense probably damaging 1.00
R7182:Fmnl3 UTSW 15 99321782 missense probably damaging 0.99
R7423:Fmnl3 UTSW 15 99329400 missense probably damaging 0.99
R7952:Fmnl3 UTSW 15 99322637 missense probably damaging 0.97
R7977:Fmnl3 UTSW 15 99328098 missense possibly damaging 0.89
R7987:Fmnl3 UTSW 15 99328098 missense possibly damaging 0.89
X0009:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0010:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0011:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0012:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0014:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0017:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0021:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0023:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0023:Fmnl3 UTSW 15 99325284 missense probably damaging 1.00
X0028:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0033:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0060:Fmnl3 UTSW 15 99320038 missense possibly damaging 0.69
X0064:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0067:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGAGTGCACCACAATGTTG -3'
(R):5'- TCTGGTGTCCAAAATGGCAC -3'

Sequencing Primer
(F):5'- GTGCACCACAATGTTGATGAACTG -3'
(R):5'- TGGCCTGAAACTATGGCAGTC -3'
Posted On2017-03-31