Incidental Mutation 'R5957:Itga5'
ID471246
Institutional Source Beutler Lab
Gene Symbol Itga5
Ensembl Gene ENSMUSG00000000555
Gene Nameintegrin alpha 5 (fibronectin receptor alpha)
SynonymsFnra, Cd49e
MMRRC Submission 043246-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5957 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location103344286-103366763 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103351429 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 647 (D647G)
Ref Sequence ENSEMBL: ENSMUSP00000023128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023128] [ENSMUST00000215331]
Predicted Effect probably benign
Transcript: ENSMUST00000023128
AA Change: D647G

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000023128
Gene: ENSMUSG00000000555
AA Change: D647G

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
Int_alpha 59 118 2.27e-8 SMART
Int_alpha 271 321 9.6e-7 SMART
Int_alpha 325 387 1.03e-15 SMART
Int_alpha 391 447 4.17e-16 SMART
Int_alpha 455 511 1.49e-3 SMART
SCOP:d1m1xa2 651 789 3e-44 SMART
SCOP:d1m1xa3 792 992 1e-62 SMART
transmembrane domain 1003 1025 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183535
Predicted Effect probably benign
Transcript: ENSMUST00000215331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230775
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: The product of this gene belongs to the integrin alpha chain family. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes the integrin alpha 5 chain, which is proteolytically processed to generate light and heavy chains that join with beta 1 to form a fibronectin receptor. In addition to adhesion, integrins are known to participate in cell-surface mediated signaling. Integrin alpha 5 and integrin alpha V chains are produced by distinct genes. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in posterior trunk and yolk sac mesodermal structures, lack of epithelialization of somites, reduced numbers of Schwann cells, and lethality around embryonic day 10-11. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,161 T1704A probably benign Het
Adgrg7 T A 16: 56,773,427 N142I probably damaging Het
Aldh18a1 A T 19: 40,570,537 Y286* probably null Het
Armc4 T C 18: 7,285,706 E219G probably benign Het
Arpp21 T C 9: 112,185,686 T17A probably benign Het
Atp5s T C 12: 69,743,784 V185A probably benign Het
Bnip2 T C 9: 69,999,238 I147T probably damaging Het
Ccr8 T C 9: 120,093,827 Y3H probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Cul7 G A 17: 46,657,757 G553S probably damaging Het
Cyp21a1 A G 17: 34,803,176 I206T probably benign Het
Dennd4b A G 3: 90,270,965 D488G probably damaging Het
Dip2b T C 15: 100,209,694 L1195P probably benign Het
Dock5 T A 14: 67,857,994 H77L probably benign Het
Fbxw13 C T 9: 109,192,666 probably null Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gbf1 G T 19: 46,246,221 probably null Het
Gm12794 T C 4: 101,941,701 F290L probably benign Het
Gm4846 T C 1: 166,486,953 I374V probably benign Het
Gsk3b C A 16: 38,193,953 P258T probably damaging Het
Igsf5 T C 16: 96,364,049 V8A probably benign Het
Il22 T A 10: 118,205,166 L59Q probably damaging Het
Ildr1 T C 16: 36,725,534 *517Q probably null Het
Iqca T A 1: 90,080,948 D450V probably damaging Het
Myh7 T G 14: 54,989,078 N408T probably damaging Het
Mylk3 T C 8: 85,328,637 M564V probably damaging Het
Nsd2 T A 5: 33,855,603 M407K probably damaging Het
Oprd1 C T 4: 132,144,163 V75I probably benign Het
Poli G A 18: 70,517,440 H310Y probably benign Het
Ptch1 C T 13: 63,525,115 R755H probably damaging Het
Pygl A T 12: 70,199,720 M351K probably damaging Het
Serpinb9b T C 13: 33,039,848 L341P possibly damaging Het
Slc47a1 A G 11: 61,344,342 V555A probably benign Het
Slc8a2 C A 7: 16,145,284 T565K possibly damaging Het
Snx14 T C 9: 88,403,274 I446V possibly damaging Het
Syde1 T C 10: 78,590,117 Y72C probably damaging Het
Trim37 C T 11: 87,145,551 R138C probably damaging Het
Tubgcp5 T A 7: 55,814,962 S530R probably benign Het
Vps13c T C 9: 67,954,971 S2957P probably damaging Het
Wdr41 T C 13: 94,997,187 probably null Het
Zyg11b T C 4: 108,245,013 K504E probably damaging Het
Other mutations in Itga5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Itga5 APN 15 103350372 critical splice donor site probably null
IGL01102:Itga5 APN 15 103346675 missense probably benign 0.13
IGL01474:Itga5 APN 15 103354270 nonsense probably null
IGL01768:Itga5 APN 15 103351570 missense probably benign 0.34
IGL01832:Itga5 APN 15 103355949 nonsense probably null
IGL02188:Itga5 APN 15 103347717 missense probably benign 0.30
IGL02701:Itga5 APN 15 103347766 missense probably damaging 0.98
IGL02838:Itga5 APN 15 103351609 missense probably damaging 1.00
IGL02955:Itga5 APN 15 103350834 missense possibly damaging 0.48
R0617:Itga5 UTSW 15 103356315 critical splice donor site probably null
R0845:Itga5 UTSW 15 103350769 missense probably benign 0.07
R1210:Itga5 UTSW 15 103357473 missense possibly damaging 0.76
R1522:Itga5 UTSW 15 103356782 nonsense probably null
R1576:Itga5 UTSW 15 103351617 missense probably damaging 0.96
R1666:Itga5 UTSW 15 103347902 missense probably benign 0.00
R1808:Itga5 UTSW 15 103350399 missense probably damaging 1.00
R1836:Itga5 UTSW 15 103346014 missense probably damaging 1.00
R1964:Itga5 UTSW 15 103354314 missense probably damaging 1.00
R4290:Itga5 UTSW 15 103352257 critical splice donor site probably null
R4458:Itga5 UTSW 15 103350203 missense probably damaging 1.00
R4610:Itga5 UTSW 15 103350832 missense probably damaging 1.00
R4676:Itga5 UTSW 15 103357210 missense probably damaging 1.00
R4795:Itga5 UTSW 15 103347760 missense probably benign 0.05
R4796:Itga5 UTSW 15 103347760 missense probably benign 0.05
R4837:Itga5 UTSW 15 103354084 missense probably damaging 0.99
R4929:Itga5 UTSW 15 103353235 missense probably benign 0.42
R5896:Itga5 UTSW 15 103351087 missense probably benign
R5947:Itga5 UTSW 15 103356785 missense probably damaging 1.00
R6153:Itga5 UTSW 15 103357453 missense probably damaging 1.00
R6353:Itga5 UTSW 15 103352523 missense probably damaging 0.98
R6657:Itga5 UTSW 15 103350795 missense probably damaging 1.00
R6698:Itga5 UTSW 15 103351381 missense probably benign 0.15
R6891:Itga5 UTSW 15 103357543 missense probably damaging 1.00
R6981:Itga5 UTSW 15 103350226 missense probably benign 0.00
R7574:Itga5 UTSW 15 103350449 missense probably damaging 1.00
R7762:Itga5 UTSW 15 103349757 missense probably benign 0.01
R7813:Itga5 UTSW 15 103357314 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGAGAAACGAATGCTCCCTG -3'
(R):5'- CCACTGGCCCTAGAATGAATCAG -3'

Sequencing Primer
(F):5'- GAGAAACGAATGCTCCCTGTAGAC -3'
(R):5'- CTGGCCCTAGAATGAATCAGAATTC -3'
Posted On2017-03-31