Mutagenetix > Incidental Mutation

Incidental Mutation 'R5957:Itga5'

471246

Institutional Source

Beutler Lab

Gene Symbol

Itga5

Ensembl Gene

ENSMUSG00000000555

Gene Name

integrin alpha 5 (fibronectin receptor alpha)

Synonyms

Fnra, Cd49e

MMRRC Submission

043246-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5957 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103344286-103366763 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103351429 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 647 (D647G)

Ref Sequence

ENSEMBL: ENSMUSP00000023128 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023128] [ENSMUST00000215331]

AlphaFold

P11688

Predicted Effect

probably benign
Transcript: ENSMUST00000023128
AA Change: D647G

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000023128
Gene: ENSMUSG00000000555
AA Change: D647G

Domain	Start	End	E-Value	Type
low complexity region	17	40	N/A	INTRINSIC
Int_alpha	59	118	2.27e-8	SMART
Int_alpha	271	321	9.6e-7	SMART
Int_alpha	325	387	1.03e-15	SMART
Int_alpha	391	447	4.17e-16	SMART
Int_alpha	455	511	1.49e-3	SMART
SCOP:d1m1xa2	651	789	3e-44	SMART
SCOP:d1m1xa3	792	992	1e-62	SMART
transmembrane domain	1003	1025	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183535

Predicted Effect

probably benign
Transcript: ENSMUST00000215331

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230775

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: The product of this gene belongs to the integrin alpha chain family. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes the integrin alpha 5 chain, which is proteolytically processed to generate light and heavy chains that join with beta 1 to form a fibronectin receptor. In addition to adhesion, integrins are known to participate in cell-surface mediated signaling. Integrin alpha 5 and integrin alpha V chains are produced by distinct genes. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in posterior trunk and yolk sac mesodermal structures, lack of epithelialization of somites, reduced numbers of Schwann cells, and lethality around embryonic day 10-11. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,070,161	T1704A	probably benign	Het
Adgrg7	T	A	16: 56,773,427	N142I	probably damaging	Het
Aldh18a1	A	T	19: 40,570,537	Y286*	probably null	Het
Armc4	T	C	18: 7,285,706	E219G	probably benign	Het
Arpp21	T	C	9: 112,185,686	T17A	probably benign	Het
Atp5s	T	C	12: 69,743,784	V185A	probably benign	Het
Bnip2	T	C	9: 69,999,238	I147T	probably damaging	Het
Ccr8	T	C	9: 120,093,827	Y3H	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Cul7	G	A	17: 46,657,757	G553S	probably damaging	Het
Cyp21a1	A	G	17: 34,803,176	I206T	probably benign	Het
Dennd4b	A	G	3: 90,270,965	D488G	probably damaging	Het
Dip2b	T	C	15: 100,209,694	L1195P	probably benign	Het
Dock5	T	A	14: 67,857,994	H77L	probably benign	Het
Fbxw13	C	T	9: 109,192,666		probably null	Het
Fmnl3	G	A	15: 99,325,910	R302W	probably damaging	Het
Gbf1	G	T	19: 46,246,221		probably null	Het
Gm12794	T	C	4: 101,941,701	F290L	probably benign	Het
Gm4846	T	C	1: 166,486,953	I374V	probably benign	Het
Gsk3b	C	A	16: 38,193,953	P258T	probably damaging	Het
Igsf5	T	C	16: 96,364,049	V8A	probably benign	Het
Il22	T	A	10: 118,205,166	L59Q	probably damaging	Het
Ildr1	T	C	16: 36,725,534	*517Q	probably null	Het
Iqca	T	A	1: 90,080,948	D450V	probably damaging	Het
Myh7	T	G	14: 54,989,078	N408T	probably damaging	Het
Mylk3	T	C	8: 85,328,637	M564V	probably damaging	Het
Nsd2	T	A	5: 33,855,603	M407K	probably damaging	Het
Oprd1	C	T	4: 132,144,163	V75I	probably benign	Het
Poli	G	A	18: 70,517,440	H310Y	probably benign	Het
Ptch1	C	T	13: 63,525,115	R755H	probably damaging	Het
Pygl	A	T	12: 70,199,720	M351K	probably damaging	Het
Serpinb9b	T	C	13: 33,039,848	L341P	possibly damaging	Het
Slc47a1	A	G	11: 61,344,342	V555A	probably benign	Het
Slc8a2	C	A	7: 16,145,284	T565K	possibly damaging	Het
Snx14	T	C	9: 88,403,274	I446V	possibly damaging	Het
Syde1	T	C	10: 78,590,117	Y72C	probably damaging	Het
Trim37	C	T	11: 87,145,551	R138C	probably damaging	Het
Tubgcp5	T	A	7: 55,814,962	S530R	probably benign	Het
Vps13c	T	C	9: 67,954,971	S2957P	probably damaging	Het
Wdr41	T	C	13: 94,997,187		probably null	Het
Zyg11b	T	C	4: 108,245,013	K504E	probably damaging	Het

Other mutations in Itga5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00914:Itga5	APN	15	103350372	critical splice donor site	probably null
IGL01102:Itga5	APN	15	103346675	missense	probably benign	0.13
IGL01474:Itga5	APN	15	103354270	nonsense	probably null
IGL01768:Itga5	APN	15	103351570	missense	probably benign	0.34
IGL01832:Itga5	APN	15	103355949	nonsense	probably null
IGL02188:Itga5	APN	15	103347717	missense	probably benign	0.30
IGL02701:Itga5	APN	15	103347766	missense	probably damaging	0.98
IGL02838:Itga5	APN	15	103351609	missense	probably damaging	1.00
IGL02955:Itga5	APN	15	103350834	missense	possibly damaging	0.48
R0617:Itga5	UTSW	15	103356315	critical splice donor site	probably null
R0845:Itga5	UTSW	15	103350769	missense	probably benign	0.07
R1210:Itga5	UTSW	15	103357473	missense	possibly damaging	0.76
R1522:Itga5	UTSW	15	103356782	nonsense	probably null
R1576:Itga5	UTSW	15	103351617	missense	probably damaging	0.96
R1666:Itga5	UTSW	15	103347902	missense	probably benign	0.00
R1808:Itga5	UTSW	15	103350399	missense	probably damaging	1.00
R1836:Itga5	UTSW	15	103346014	missense	probably damaging	1.00
R1964:Itga5	UTSW	15	103354314	missense	probably damaging	1.00
R4290:Itga5	UTSW	15	103352257	critical splice donor site	probably null
R4458:Itga5	UTSW	15	103350203	missense	probably damaging	1.00
R4610:Itga5	UTSW	15	103350832	missense	probably damaging	1.00
R4676:Itga5	UTSW	15	103357210	missense	probably damaging	1.00
R4795:Itga5	UTSW	15	103347760	missense	probably benign	0.05
R4796:Itga5	UTSW	15	103347760	missense	probably benign	0.05
R4837:Itga5	UTSW	15	103354084	missense	probably damaging	0.99
R4929:Itga5	UTSW	15	103353235	missense	probably benign	0.42
R5896:Itga5	UTSW	15	103351087	missense	probably benign
R5947:Itga5	UTSW	15	103356785	missense	probably damaging	1.00
R6153:Itga5	UTSW	15	103357453	missense	probably damaging	1.00
R6353:Itga5	UTSW	15	103352523	missense	probably damaging	0.98
R6657:Itga5	UTSW	15	103350795	missense	probably damaging	1.00
R6698:Itga5	UTSW	15	103351381	missense	probably benign	0.15
R6891:Itga5	UTSW	15	103357543	missense	probably damaging	1.00
R6981:Itga5	UTSW	15	103350226	missense	probably benign	0.00
R7574:Itga5	UTSW	15	103350449	missense	probably damaging	1.00
R7762:Itga5	UTSW	15	103349757	missense	probably benign	0.01
R7813:Itga5	UTSW	15	103357314	critical splice acceptor site	probably null
R7984:Itga5	UTSW	15	103355952	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGAAACGAATGCTCCCTG -3'
(R):5'- CCACTGGCCCTAGAATGAATCAG -3'

Sequencing Primer
(F):5'- GAGAAACGAATGCTCCCTGTAGAC -3'
(R):5'- CTGGCCCTAGAATGAATCAGAATTC -3'

Posted On

2017-03-31