Incidental Mutation 'R5957:Ildr1'
ID 471247
Institutional Source Beutler Lab
Gene Symbol Ildr1
Ensembl Gene ENSMUSG00000022900
Gene Name immunoglobulin-like domain containing receptor 1
Synonyms
MMRRC Submission 043246-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5957 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 36693978-36726804 bp(+) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) T to C at 36725534 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Glutamine at position 517 (*517Q)
Ref Sequence ENSEMBL: ENSMUSP00000112539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023617] [ENSMUST00000089618] [ENSMUST00000119464]
AlphaFold Q8CBR1
Predicted Effect silent
Transcript: ENSMUST00000023617
SMART Domains Protein: ENSMUSP00000023617
Gene: ENSMUSG00000022900

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 29 165 2.34e-4 SMART
Pfam:LSR 166 213 3e-27 PFAM
low complexity region 255 268 N/A INTRINSIC
low complexity region 424 472 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000089618
SMART Domains Protein: ENSMUSP00000087045
Gene: ENSMUSG00000022900

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 29 165 2.34e-4 SMART
Pfam:LSR 166 214 2.8e-27 PFAM
low complexity region 380 428 N/A INTRINSIC
low complexity region 437 445 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119464
AA Change: *517Q
SMART Domains Protein: ENSMUSP00000112539
Gene: ENSMUSG00000022900
AA Change: *517Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 29 165 2.34e-4 SMART
Pfam:LSR 166 214 3e-27 PFAM
low complexity region 255 268 N/A INTRINSIC
low complexity region 424 472 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128084
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains an immunoglobulin-like domain. The encoded protein may function as a multimeric receptor at the cell surface. The expression of this gene may be a diagnostic marker for cancer progression. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous inactivation of this gene leads to progressive cochlear hair cell degeneration and profound deafness. Mice homozygous for a gene trap allele also exhibit impaired lipid-induced cholecystokinin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,161 T1704A probably benign Het
Adgrg7 T A 16: 56,773,427 N142I probably damaging Het
Aldh18a1 A T 19: 40,570,537 Y286* probably null Het
Armc4 T C 18: 7,285,706 E219G probably benign Het
Arpp21 T C 9: 112,185,686 T17A probably benign Het
Atp5s T C 12: 69,743,784 V185A probably benign Het
Bnip2 T C 9: 69,999,238 I147T probably damaging Het
Ccr8 T C 9: 120,093,827 Y3H probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Cul7 G A 17: 46,657,757 G553S probably damaging Het
Cyp21a1 A G 17: 34,803,176 I206T probably benign Het
Dennd4b A G 3: 90,270,965 D488G probably damaging Het
Dip2b T C 15: 100,209,694 L1195P probably benign Het
Dock5 T A 14: 67,857,994 H77L probably benign Het
Fbxw13 C T 9: 109,192,666 probably null Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gbf1 G T 19: 46,246,221 probably null Het
Gm12794 T C 4: 101,941,701 F290L probably benign Het
Gm4846 T C 1: 166,486,953 I374V probably benign Het
Gsk3b C A 16: 38,193,953 P258T probably damaging Het
Igsf5 T C 16: 96,364,049 V8A probably benign Het
Il22 T A 10: 118,205,166 L59Q probably damaging Het
Iqca T A 1: 90,080,948 D450V probably damaging Het
Itga5 T C 15: 103,351,429 D647G probably benign Het
Myh7 T G 14: 54,989,078 N408T probably damaging Het
Mylk3 T C 8: 85,328,637 M564V probably damaging Het
Nsd2 T A 5: 33,855,603 M407K probably damaging Het
Oprd1 C T 4: 132,144,163 V75I probably benign Het
Poli G A 18: 70,517,440 H310Y probably benign Het
Ptch1 C T 13: 63,525,115 R755H probably damaging Het
Pygl A T 12: 70,199,720 M351K probably damaging Het
Serpinb9b T C 13: 33,039,848 L341P possibly damaging Het
Slc47a1 A G 11: 61,344,342 V555A probably benign Het
Slc8a2 C A 7: 16,145,284 T565K possibly damaging Het
Snx14 T C 9: 88,403,274 I446V possibly damaging Het
Syde1 T C 10: 78,590,117 Y72C probably damaging Het
Trim37 C T 11: 87,145,551 R138C probably damaging Het
Tubgcp5 T A 7: 55,814,962 S530R probably benign Het
Vps13c T C 9: 67,954,971 S2957P probably damaging Het
Wdr41 T C 13: 94,997,187 probably null Het
Zyg11b T C 4: 108,245,013 K504E probably damaging Het
Other mutations in Ildr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02501:Ildr1 APN 16 36722350 missense probably damaging 1.00
IGL02505:Ildr1 APN 16 36716164 missense probably damaging 1.00
R0295:Ildr1 UTSW 16 36709477 critical splice acceptor site probably null
R1649:Ildr1 UTSW 16 36708319 missense probably damaging 1.00
R1728:Ildr1 UTSW 16 36708336 missense possibly damaging 0.80
R1990:Ildr1 UTSW 16 36716206 missense probably damaging 0.99
R2020:Ildr1 UTSW 16 36725541 missense probably damaging 0.97
R2110:Ildr1 UTSW 16 36721979 missense probably damaging 1.00
R2111:Ildr1 UTSW 16 36721979 missense probably damaging 1.00
R4755:Ildr1 UTSW 16 36722021 missense probably benign 0.00
R4798:Ildr1 UTSW 16 36722555 missense possibly damaging 0.66
R4973:Ildr1 UTSW 16 36708298 missense probably benign 0.10
R5014:Ildr1 UTSW 16 36721559 missense probably damaging 0.98
R5426:Ildr1 UTSW 16 36709619 missense probably damaging 1.00
R7058:Ildr1 UTSW 16 36722368 missense probably benign 0.01
R7646:Ildr1 UTSW 16 36721919 missense possibly damaging 0.78
R8245:Ildr1 UTSW 16 36709521 missense probably damaging 1.00
R8392:Ildr1 UTSW 16 36722358 nonsense probably null
R8392:Ildr1 UTSW 16 36722359 missense probably damaging 1.00
R8748:Ildr1 UTSW 16 36722372 missense probably benign 0.18
R8791:Ildr1 UTSW 16 36708400 missense probably damaging 0.96
R8854:Ildr1 UTSW 16 36715548 missense probably damaging 1.00
R9108:Ildr1 UTSW 16 36715557 missense probably benign 0.13
R9252:Ildr1 UTSW 16 36716212 missense probably damaging 1.00
R9372:Ildr1 UTSW 16 36722359 missense probably damaging 1.00
R9434:Ildr1 UTSW 16 36709500 missense probably damaging 1.00
R9642:Ildr1 UTSW 16 36716128 missense probably damaging 1.00
R9681:Ildr1 UTSW 16 36708387 missense probably damaging 1.00
R9707:Ildr1 UTSW 16 36709530 missense probably damaging 1.00
R9777:Ildr1 UTSW 16 36708297 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TCCACAGTGTTGGAGGAAGG -3'
(R):5'- GAGCCCTTACAAGTCAGAGATC -3'

Sequencing Primer
(F):5'- CAGTGTTGGAGGAAGGCCATTG -3'
(R):5'- GGGGGAAAGCTTGCTATTAATTCCAC -3'
Posted On 2017-03-31