Incidental Mutation 'R5957:Igsf5'
ID 471252
Institutional Source Beutler Lab
Gene Symbol Igsf5
Ensembl Gene ENSMUSG00000000159
Gene Name immunoglobulin superfamily, member 5
Synonyms Igsf5, Jam4, 2010003D20Rik
MMRRC Submission 043246-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R5957 (G1)
Quality Score 164
Status Not validated
Chromosome 16
Chromosomal Location 96162868-96223321 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96165249 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 8 (V8A)
Ref Sequence ENSEMBL: ENSMUSP00000000163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000163] [ENSMUST00000081093] [ENSMUST00000113794] [ENSMUST00000113795]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000000163
AA Change: V8A

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000000163
Gene: ENSMUSG00000000159
AA Change: V8A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 127 9.63e-6 SMART
IG 134 221 2.64e0 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081093
AA Change: V8A

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000079874
Gene: ENSMUSG00000000159
AA Change: V8A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113794
AA Change: V8A

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000109425
Gene: ENSMUSG00000000159
AA Change: V8A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 127 9.63e-6 SMART
IG 134 221 2.64e0 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113795
AA Change: V8A
SMART Domains Protein: ENSMUSP00000109426
Gene: ENSMUSG00000000159
AA Change: V8A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,775,922 (GRCm39) T1704A probably benign Het
Adgrg7 T A 16: 56,593,790 (GRCm39) N142I probably damaging Het
Aldh18a1 A T 19: 40,558,981 (GRCm39) Y286* probably null Het
Arpp21 T C 9: 112,014,754 (GRCm39) T17A probably benign Het
Bnip2 T C 9: 69,906,520 (GRCm39) I147T probably damaging Het
Ccr8 T C 9: 119,922,893 (GRCm39) Y3H probably damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
Cul7 G A 17: 46,968,683 (GRCm39) G553S probably damaging Het
Cyp21a1 A G 17: 35,022,150 (GRCm39) I206T probably benign Het
Dennd4b A G 3: 90,178,272 (GRCm39) D488G probably damaging Het
Dip2b T C 15: 100,107,575 (GRCm39) L1195P probably benign Het
Dmac2l T C 12: 69,790,558 (GRCm39) V185A probably benign Het
Dock5 T A 14: 68,095,443 (GRCm39) H77L probably benign Het
Fbxw13 C T 9: 109,021,734 (GRCm39) probably null Het
Fmnl3 G A 15: 99,223,791 (GRCm39) R302W probably damaging Het
Gbf1 G T 19: 46,234,660 (GRCm39) probably null Het
Gm4846 T C 1: 166,314,522 (GRCm39) I374V probably benign Het
Gsk3b C A 16: 38,014,315 (GRCm39) P258T probably damaging Het
Il22 T A 10: 118,041,071 (GRCm39) L59Q probably damaging Het
Ildr1 T C 16: 36,545,896 (GRCm39) *517Q probably null Het
Iqca1 T A 1: 90,008,670 (GRCm39) D450V probably damaging Het
Itga5 T C 15: 103,259,856 (GRCm39) D647G probably benign Het
Myh7 T G 14: 55,226,535 (GRCm39) N408T probably damaging Het
Mylk3 T C 8: 86,055,266 (GRCm39) M564V probably damaging Het
Nsd2 T A 5: 34,012,947 (GRCm39) M407K probably damaging Het
Odad2 T C 18: 7,285,706 (GRCm39) E219G probably benign Het
Oprd1 C T 4: 131,871,474 (GRCm39) V75I probably benign Het
Poli G A 18: 70,650,511 (GRCm39) H310Y probably benign Het
Pramel19 T C 4: 101,798,898 (GRCm39) F290L probably benign Het
Ptch1 C T 13: 63,672,929 (GRCm39) R755H probably damaging Het
Pygl A T 12: 70,246,494 (GRCm39) M351K probably damaging Het
Serpinb9b T C 13: 33,223,831 (GRCm39) L341P possibly damaging Het
Slc47a1 A G 11: 61,235,168 (GRCm39) V555A probably benign Het
Slc8a2 C A 7: 15,879,209 (GRCm39) T565K possibly damaging Het
Snx14 T C 9: 88,285,327 (GRCm39) I446V possibly damaging Het
Syde1 T C 10: 78,425,951 (GRCm39) Y72C probably damaging Het
Trim37 C T 11: 87,036,377 (GRCm39) R138C probably damaging Het
Tubgcp5 T A 7: 55,464,710 (GRCm39) S530R probably benign Het
Vps13c T C 9: 67,862,253 (GRCm39) S2957P probably damaging Het
Wdr41 T C 13: 95,133,695 (GRCm39) probably null Het
Zyg11b T C 4: 108,102,210 (GRCm39) K504E probably damaging Het
Other mutations in Igsf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Igsf5 APN 16 96,192,220 (GRCm39) missense possibly damaging 0.72
IGL01335:Igsf5 APN 16 96,174,353 (GRCm39) splice site probably benign
IGL02576:Igsf5 APN 16 96,187,781 (GRCm39) missense probably benign 0.23
IGL02721:Igsf5 APN 16 96,192,222 (GRCm39) missense probably damaging 0.98
IGL03289:Igsf5 APN 16 96,326,632 (GRCm39) missense possibly damaging 0.94
R0630:Igsf5 UTSW 16 96,174,023 (GRCm39) splice site probably benign
R1858:Igsf5 UTSW 16 96,187,829 (GRCm39) splice site probably null
R1961:Igsf5 UTSW 16 96,179,551 (GRCm39) missense probably damaging 1.00
R2508:Igsf5 UTSW 16 96,165,247 (GRCm39) missense probably benign 0.01
R4491:Igsf5 UTSW 16 96,165,281 (GRCm39) missense probably benign 0.02
R5123:Igsf5 UTSW 16 96,174,279 (GRCm39) missense probably damaging 1.00
R5262:Igsf5 UTSW 16 96,192,237 (GRCm39) nonsense probably null
R5384:Igsf5 UTSW 16 96,192,226 (GRCm39) missense probably benign 0.21
R5558:Igsf5 UTSW 16 96,187,731 (GRCm39) missense possibly damaging 0.95
R5950:Igsf5 UTSW 16 96,174,072 (GRCm39) missense probably benign 0.07
R6199:Igsf5 UTSW 16 96,222,939 (GRCm39) missense possibly damaging 0.66
R6298:Igsf5 UTSW 16 96,197,648 (GRCm39) missense possibly damaging 0.93
R7164:Igsf5 UTSW 16 96,174,048 (GRCm39) missense possibly damaging 0.85
R7197:Igsf5 UTSW 16 96,204,546 (GRCm39) missense probably damaging 1.00
R8213:Igsf5 UTSW 16 96,174,188 (GRCm39) missense probably damaging 1.00
R8353:Igsf5 UTSW 16 96,222,996 (GRCm39) missense probably benign 0.00
R8453:Igsf5 UTSW 16 96,222,996 (GRCm39) missense probably benign 0.00
R8823:Igsf5 UTSW 16 96,222,939 (GRCm39) missense possibly damaging 0.66
R9798:Igsf5 UTSW 16 96,174,075 (GRCm39) missense probably damaging 1.00
Z1176:Igsf5 UTSW 16 96,192,223 (GRCm39) missense probably damaging 1.00
Z1177:Igsf5 UTSW 16 96,179,533 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCCCCAAAATGCATACTCTG -3'
(R):5'- AAGGATTGCCTATAGGGGTGAC -3'

Sequencing Primer
(F):5'- CAGTAGATCCTCTTGGCT -3'
(R):5'- AGTACCTGAGGAGGACCACC -3'
Posted On 2017-03-31