Incidental Mutation 'R5957:Igsf5'
ID471252
Institutional Source Beutler Lab
Gene Symbol Igsf5
Ensembl Gene ENSMUSG00000000159
Gene Nameimmunoglobulin superfamily, member 5
SynonymsIgsf5, Jam4
MMRRC Submission 043246-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R5957 (G1)
Quality Score164
Status Not validated
Chromosome16
Chromosomal Location96361668-96525580 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96364049 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 8 (V8A)
Ref Sequence ENSEMBL: ENSMUSP00000000163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000163] [ENSMUST00000081093] [ENSMUST00000113794] [ENSMUST00000113795]
Predicted Effect probably benign
Transcript: ENSMUST00000000163
AA Change: V8A

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000000163
Gene: ENSMUSG00000000159
AA Change: V8A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 127 9.63e-6 SMART
IG 134 221 2.64e0 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081093
AA Change: V8A

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000079874
Gene: ENSMUSG00000000159
AA Change: V8A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113794
AA Change: V8A

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000109425
Gene: ENSMUSG00000000159
AA Change: V8A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 127 9.63e-6 SMART
IG 134 221 2.64e0 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113795
AA Change: V8A
SMART Domains Protein: ENSMUSP00000109426
Gene: ENSMUSG00000000159
AA Change: V8A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,161 T1704A probably benign Het
Adgrg7 T A 16: 56,773,427 N142I probably damaging Het
Aldh18a1 A T 19: 40,570,537 Y286* probably null Het
Armc4 T C 18: 7,285,706 E219G probably benign Het
Arpp21 T C 9: 112,185,686 T17A probably benign Het
Atp5s T C 12: 69,743,784 V185A probably benign Het
Bnip2 T C 9: 69,999,238 I147T probably damaging Het
Ccr8 T C 9: 120,093,827 Y3H probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Cul7 G A 17: 46,657,757 G553S probably damaging Het
Cyp21a1 A G 17: 34,803,176 I206T probably benign Het
Dennd4b A G 3: 90,270,965 D488G probably damaging Het
Dip2b T C 15: 100,209,694 L1195P probably benign Het
Dock5 T A 14: 67,857,994 H77L probably benign Het
Fbxw13 C T 9: 109,192,666 probably null Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gbf1 G T 19: 46,246,221 probably null Het
Gm12794 T C 4: 101,941,701 F290L probably benign Het
Gm4846 T C 1: 166,486,953 I374V probably benign Het
Gsk3b C A 16: 38,193,953 P258T probably damaging Het
Il22 T A 10: 118,205,166 L59Q probably damaging Het
Ildr1 T C 16: 36,725,534 *517Q probably null Het
Iqca T A 1: 90,080,948 D450V probably damaging Het
Itga5 T C 15: 103,351,429 D647G probably benign Het
Myh7 T G 14: 54,989,078 N408T probably damaging Het
Mylk3 T C 8: 85,328,637 M564V probably damaging Het
Nsd2 T A 5: 33,855,603 M407K probably damaging Het
Oprd1 C T 4: 132,144,163 V75I probably benign Het
Poli G A 18: 70,517,440 H310Y probably benign Het
Ptch1 C T 13: 63,525,115 R755H probably damaging Het
Pygl A T 12: 70,199,720 M351K probably damaging Het
Serpinb9b T C 13: 33,039,848 L341P possibly damaging Het
Slc47a1 A G 11: 61,344,342 V555A probably benign Het
Slc8a2 C A 7: 16,145,284 T565K possibly damaging Het
Snx14 T C 9: 88,403,274 I446V possibly damaging Het
Syde1 T C 10: 78,590,117 Y72C probably damaging Het
Trim37 C T 11: 87,145,551 R138C probably damaging Het
Tubgcp5 T A 7: 55,814,962 S530R probably benign Het
Vps13c T C 9: 67,954,971 S2957P probably damaging Het
Wdr41 T C 13: 94,997,187 probably null Het
Zyg11b T C 4: 108,245,013 K504E probably damaging Het
Other mutations in Igsf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Igsf5 APN 16 96391020 missense possibly damaging 0.72
IGL01335:Igsf5 APN 16 96373153 splice site probably benign
IGL02576:Igsf5 APN 16 96386581 missense probably benign 0.23
IGL02721:Igsf5 APN 16 96391022 missense probably damaging 0.98
IGL03289:Igsf5 APN 16 96525432 missense possibly damaging 0.94
R0630:Igsf5 UTSW 16 96372823 splice site probably benign
R1858:Igsf5 UTSW 16 96386629 splice site probably null
R1961:Igsf5 UTSW 16 96378351 missense probably damaging 1.00
R2508:Igsf5 UTSW 16 96364047 missense probably benign 0.01
R4491:Igsf5 UTSW 16 96364081 missense probably benign 0.02
R5123:Igsf5 UTSW 16 96373079 missense probably damaging 1.00
R5262:Igsf5 UTSW 16 96391037 nonsense probably null
R5384:Igsf5 UTSW 16 96391026 missense probably benign 0.21
R5558:Igsf5 UTSW 16 96386531 missense possibly damaging 0.95
R5950:Igsf5 UTSW 16 96372872 missense probably benign 0.07
R6199:Igsf5 UTSW 16 96421739 missense possibly damaging 0.66
R6298:Igsf5 UTSW 16 96396448 missense possibly damaging 0.93
R7164:Igsf5 UTSW 16 96372848 missense possibly damaging 0.85
R7197:Igsf5 UTSW 16 96403346 missense probably damaging 1.00
R8213:Igsf5 UTSW 16 96372988 missense probably damaging 1.00
R8353:Igsf5 UTSW 16 96421796 missense probably benign 0.00
R8453:Igsf5 UTSW 16 96421796 missense probably benign 0.00
Z1176:Igsf5 UTSW 16 96391023 missense probably damaging 1.00
Z1177:Igsf5 UTSW 16 96378333 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCCCCAAAATGCATACTCTG -3'
(R):5'- AAGGATTGCCTATAGGGGTGAC -3'

Sequencing Primer
(F):5'- CAGTAGATCCTCTTGGCT -3'
(R):5'- AGTACCTGAGGAGGACCACC -3'
Posted On2017-03-31