Incidental Mutation 'R5957:Cyp21a1'
ID471253
Institutional Source Beutler Lab
Gene Symbol Cyp21a1
Ensembl Gene ENSMUSG00000024365
Gene Namecytochrome P450, family 21, subfamily a, polypeptide 1
SynonymsOh21-1, 21OHA, 21-hydroxylase, 21-OH, Cyp21, 21OH, Oh21-1
MMRRC Submission 043246-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.691) question?
Stock #R5957 (G1)
Quality Score139
Status Not validated
Chromosome17
Chromosomal Location34801348-34804561 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34803176 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 206 (I206T)
Ref Sequence ENSEMBL: ENSMUSP00000025223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025223]
Predicted Effect probably benign
Transcript: ENSMUST00000025223
AA Change: I206T

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025223
Gene: ENSMUSG00000024365
AA Change: I206T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:p450 29 473 3.9e-98 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173970
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and hydroxylates steroids at the 21 position. Its activity is required for the synthesis of steroid hormones including cortisol and aldosterone. Mutations in this gene cause congenital adrenal hyperplasia. A related pseudogene is located near this gene; gene conversion events involving the functional gene and the pseudogene are thought to account for many cases of steroid 21-hydroxylase deficiency. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: An 80kb deletion including Cyp21a1 is found in mice with the H2 haplotype aw18. Homozygotes are lethal, but can be rescued with a Cyp21a1 transgene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,161 T1704A probably benign Het
Adgrg7 T A 16: 56,773,427 N142I probably damaging Het
Aldh18a1 A T 19: 40,570,537 Y286* probably null Het
Armc4 T C 18: 7,285,706 E219G probably benign Het
Arpp21 T C 9: 112,185,686 T17A probably benign Het
Atp5s T C 12: 69,743,784 V185A probably benign Het
Bnip2 T C 9: 69,999,238 I147T probably damaging Het
Ccr8 T C 9: 120,093,827 Y3H probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Cul7 G A 17: 46,657,757 G553S probably damaging Het
Dennd4b A G 3: 90,270,965 D488G probably damaging Het
Dip2b T C 15: 100,209,694 L1195P probably benign Het
Dock5 T A 14: 67,857,994 H77L probably benign Het
Fbxw13 C T 9: 109,192,666 probably null Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gbf1 G T 19: 46,246,221 probably null Het
Gm12794 T C 4: 101,941,701 F290L probably benign Het
Gm4846 T C 1: 166,486,953 I374V probably benign Het
Gsk3b C A 16: 38,193,953 P258T probably damaging Het
Igsf5 T C 16: 96,364,049 V8A probably benign Het
Il22 T A 10: 118,205,166 L59Q probably damaging Het
Ildr1 T C 16: 36,725,534 *517Q probably null Het
Iqca T A 1: 90,080,948 D450V probably damaging Het
Itga5 T C 15: 103,351,429 D647G probably benign Het
Myh7 T G 14: 54,989,078 N408T probably damaging Het
Mylk3 T C 8: 85,328,637 M564V probably damaging Het
Nsd2 T A 5: 33,855,603 M407K probably damaging Het
Oprd1 C T 4: 132,144,163 V75I probably benign Het
Poli G A 18: 70,517,440 H310Y probably benign Het
Ptch1 C T 13: 63,525,115 R755H probably damaging Het
Pygl A T 12: 70,199,720 M351K probably damaging Het
Serpinb9b T C 13: 33,039,848 L341P possibly damaging Het
Slc47a1 A G 11: 61,344,342 V555A probably benign Het
Slc8a2 C A 7: 16,145,284 T565K possibly damaging Het
Snx14 T C 9: 88,403,274 I446V possibly damaging Het
Syde1 T C 10: 78,590,117 Y72C probably damaging Het
Trim37 C T 11: 87,145,551 R138C probably damaging Het
Tubgcp5 T A 7: 55,814,962 S530R probably benign Het
Vps13c T C 9: 67,954,971 S2957P probably damaging Het
Wdr41 T C 13: 94,997,187 probably null Het
Zyg11b T C 4: 108,245,013 K504E probably damaging Het
Other mutations in Cyp21a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Cyp21a1 APN 17 34804134 critical splice acceptor site probably null
IGL01688:Cyp21a1 APN 17 34802220 missense probably damaging 1.00
IGL02352:Cyp21a1 APN 17 34804222 missense probably damaging 1.00
IGL02359:Cyp21a1 APN 17 34804222 missense probably damaging 1.00
IGL02418:Cyp21a1 APN 17 34804188 splice site probably benign
IGL03089:Cyp21a1 APN 17 34803446 splice site probably null
R0480:Cyp21a1 UTSW 17 34801826 missense probably damaging 1.00
R1386:Cyp21a1 UTSW 17 34802210 missense probably damaging 0.98
R1831:Cyp21a1 UTSW 17 34804035 splice site probably benign
R2159:Cyp21a1 UTSW 17 34802404 missense probably benign 0.21
R2209:Cyp21a1 UTSW 17 34802727 nonsense probably null
R4968:Cyp21a1 UTSW 17 34803409 missense possibly damaging 0.93
R6374:Cyp21a1 UTSW 17 34804136 splice site probably null
R7077:Cyp21a1 UTSW 17 34802359 missense probably damaging 1.00
R7143:Cyp21a1 UTSW 17 34802326 missense probably damaging 1.00
R7798:Cyp21a1 UTSW 17 34804321 missense probably benign 0.30
R8192:Cyp21a1 UTSW 17 34803659 missense probably damaging 1.00
R8359:Cyp21a1 UTSW 17 34802131 critical splice donor site probably null
R8460:Cyp21a1 UTSW 17 34802870 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATTGTGTGTCCAGCAGTGG -3'
(R):5'- AAGGTCCATGTTACCCTCTTGC -3'

Sequencing Primer
(F):5'- AGGCACATCACTGGCTGAG -3'
(R):5'- ATGTTACCCTCTTGCCCACC -3'
Posted On2017-03-31