Incidental Mutation 'R5957:Cul7'
ID 471254
Institutional Source Beutler Lab
Gene Symbol Cul7
Ensembl Gene ENSMUSG00000038545
Gene Name cullin 7
Synonyms p185, 2510004L20Rik, C230011P08Rik, p193
MMRRC Submission 043246-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5957 (G1)
Quality Score 203
Status Not validated
Chromosome 17
Chromosomal Location 46650337-46664364 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 46657757 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 553 (G553S)
Ref Sequence ENSEMBL: ENSMUSP00000119393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043464] [ENSMUST00000133393] [ENSMUST00000145567]
AlphaFold Q8VE73
Predicted Effect probably damaging
Transcript: ENSMUST00000043464
AA Change: G851S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049128
Gene: ENSMUSG00000038545
AA Change: G851S

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 218 229 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
Pfam:Cul7 349 423 5.7e-34 PFAM
low complexity region 462 476 N/A INTRINSIC
low complexity region 603 618 N/A INTRINSIC
low complexity region 635 648 N/A INTRINSIC
APC10 811 973 9.35e-49 SMART
low complexity region 983 993 N/A INTRINSIC
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1301 1318 N/A INTRINSIC
low complexity region 1335 1370 N/A INTRINSIC
Blast:Cullin_Nedd8 1550 1633 1e-41 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132790
Predicted Effect probably damaging
Transcript: ENSMUST00000133393
AA Change: G553S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119393
Gene: ENSMUSG00000038545
AA Change: G553S

DomainStartEndE-ValueType
low complexity region 17 26 N/A INTRINSIC
Pfam:Cul7 51 126 8e-34 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
SCOP:d1gqpa_ 487 568 1e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144966
Predicted Effect probably benign
Transcript: ENSMUST00000145567
SMART Domains Protein: ENSMUSP00000116133
Gene: ENSMUSG00000038545

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
SCOP:d1jdha_ 63 222 2e-4 SMART
low complexity region 315 324 N/A INTRINSIC
Pfam:Cul7 349 424 9.5e-34 PFAM
low complexity region 462 476 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of an E3 ubiquitin-protein ligase complex. The encoded protein interacts with TP53, CUL9, and FBXW8 proteins. Defects in this gene are a cause of 3M syndrome type 1 (3M1). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: During late gestation, homozygous null fetuses display reduced growth associated with abnormal placental development and hemorrhaging due to vascular defects. Mutant mice are born but die shortly after birth, succumbing to respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,161 T1704A probably benign Het
Adgrg7 T A 16: 56,773,427 N142I probably damaging Het
Aldh18a1 A T 19: 40,570,537 Y286* probably null Het
Armc4 T C 18: 7,285,706 E219G probably benign Het
Arpp21 T C 9: 112,185,686 T17A probably benign Het
Atp5s T C 12: 69,743,784 V185A probably benign Het
Bnip2 T C 9: 69,999,238 I147T probably damaging Het
Ccr8 T C 9: 120,093,827 Y3H probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Cyp21a1 A G 17: 34,803,176 I206T probably benign Het
Dennd4b A G 3: 90,270,965 D488G probably damaging Het
Dip2b T C 15: 100,209,694 L1195P probably benign Het
Dock5 T A 14: 67,857,994 H77L probably benign Het
Fbxw13 C T 9: 109,192,666 probably null Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gbf1 G T 19: 46,246,221 probably null Het
Gm12794 T C 4: 101,941,701 F290L probably benign Het
Gm4846 T C 1: 166,486,953 I374V probably benign Het
Gsk3b C A 16: 38,193,953 P258T probably damaging Het
Igsf5 T C 16: 96,364,049 V8A probably benign Het
Il22 T A 10: 118,205,166 L59Q probably damaging Het
Ildr1 T C 16: 36,725,534 *517Q probably null Het
Iqca T A 1: 90,080,948 D450V probably damaging Het
Itga5 T C 15: 103,351,429 D647G probably benign Het
Myh7 T G 14: 54,989,078 N408T probably damaging Het
Mylk3 T C 8: 85,328,637 M564V probably damaging Het
Nsd2 T A 5: 33,855,603 M407K probably damaging Het
Oprd1 C T 4: 132,144,163 V75I probably benign Het
Poli G A 18: 70,517,440 H310Y probably benign Het
Ptch1 C T 13: 63,525,115 R755H probably damaging Het
Pygl A T 12: 70,199,720 M351K probably damaging Het
Serpinb9b T C 13: 33,039,848 L341P possibly damaging Het
Slc47a1 A G 11: 61,344,342 V555A probably benign Het
Slc8a2 C A 7: 16,145,284 T565K possibly damaging Het
Snx14 T C 9: 88,403,274 I446V possibly damaging Het
Syde1 T C 10: 78,590,117 Y72C probably damaging Het
Trim37 C T 11: 87,145,551 R138C probably damaging Het
Tubgcp5 T A 7: 55,814,962 S530R probably benign Het
Vps13c T C 9: 67,954,971 S2957P probably damaging Het
Wdr41 T C 13: 94,997,187 probably null Het
Zyg11b T C 4: 108,245,013 K504E probably damaging Het
Other mutations in Cul7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Cul7 APN 17 46652508 missense probably damaging 1.00
IGL01288:Cul7 APN 17 46657807 splice site probably benign
IGL01669:Cul7 APN 17 46658715 missense possibly damaging 0.94
P0019:Cul7 UTSW 17 46660247 splice site probably benign
PIT4453001:Cul7 UTSW 17 46651820 missense probably damaging 0.99
R0083:Cul7 UTSW 17 46655556 missense probably benign 0.00
R0121:Cul7 UTSW 17 46663373 missense probably damaging 1.00
R0157:Cul7 UTSW 17 46653835 missense possibly damaging 0.93
R0266:Cul7 UTSW 17 46654595 missense probably benign 0.00
R0358:Cul7 UTSW 17 46663744 critical splice donor site probably null
R0544:Cul7 UTSW 17 46663544 missense possibly damaging 0.94
R0565:Cul7 UTSW 17 46652003 missense probably damaging 0.98
R0677:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0696:Cul7 UTSW 17 46659608 missense probably damaging 1.00
R0702:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0735:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0893:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0900:Cul7 UTSW 17 46658337 missense probably benign 0.36
R0975:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0976:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1014:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1016:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1104:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1162:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1378:Cul7 UTSW 17 46662126 missense probably damaging 0.99
R1479:Cul7 UTSW 17 46651747 missense probably damaging 1.00
R1498:Cul7 UTSW 17 46655710 missense probably benign 0.01
R1521:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1542:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1545:Cul7 UTSW 17 46651553 missense probably damaging 1.00
R1598:Cul7 UTSW 17 46663091 missense probably benign 0.10
R1600:Cul7 UTSW 17 46651822 nonsense probably null
R1618:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1752:Cul7 UTSW 17 46653167 missense probably benign 0.10
R1881:Cul7 UTSW 17 46651962 missense probably damaging 1.00
R1901:Cul7 UTSW 17 46655740 missense probably damaging 1.00
R1902:Cul7 UTSW 17 46655740 missense probably damaging 1.00
R1913:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R2213:Cul7 UTSW 17 46651472 missense probably damaging 0.99
R2370:Cul7 UTSW 17 46661641 missense probably damaging 1.00
R2929:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2930:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2990:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2992:Cul7 UTSW 17 46651600 missense probably benign 0.00
R4201:Cul7 UTSW 17 46661312 missense probably damaging 1.00
R4792:Cul7 UTSW 17 46657050 nonsense probably null
R4971:Cul7 UTSW 17 46659119 missense probably benign 0.00
R5014:Cul7 UTSW 17 46655942 makesense probably null
R5384:Cul7 UTSW 17 46654477 missense probably benign 0.44
R6128:Cul7 UTSW 17 46651662 missense probably damaging 1.00
R6294:Cul7 UTSW 17 46663148 missense probably benign
R6812:Cul7 UTSW 17 46661409 missense probably benign 0.00
R7073:Cul7 UTSW 17 46658731 missense probably damaging 1.00
R7112:Cul7 UTSW 17 46651698 missense probably damaging 1.00
R7246:Cul7 UTSW 17 46662067 missense probably benign 0.04
R7361:Cul7 UTSW 17 46657007 missense probably damaging 1.00
R7567:Cul7 UTSW 17 46654595 missense probably benign 0.00
R7682:Cul7 UTSW 17 46655595 missense probably benign
R7689:Cul7 UTSW 17 46652821 nonsense probably null
R7797:Cul7 UTSW 17 46658642 missense possibly damaging 0.65
R7897:Cul7 UTSW 17 46658005 missense probably benign
R8783:Cul7 UTSW 17 46655649 missense probably benign
R9047:Cul7 UTSW 17 46654522 missense probably benign 0.01
R9167:Cul7 UTSW 17 46655697 missense probably benign 0.14
R9614:Cul7 UTSW 17 46664286 missense probably damaging 1.00
Z1177:Cul7 UTSW 17 46652805 frame shift probably null
Z1177:Cul7 UTSW 17 46658738 missense probably damaging 0.99
Z1177:Cul7 UTSW 17 46659569 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTTGTACCTGGACTATGACCTTC -3'
(R):5'- AACGGACTTGATGCTGTTGC -3'

Sequencing Primer
(F):5'- GCTCCAGTGAGGAAATGA -3'
(R):5'- ATGTAGCTTGAGTCCTCGCCAG -3'
Posted On 2017-03-31