Incidental Mutation 'R5958:Ahctf1'
ID471262
Institutional Source Beutler Lab
Gene Symbol Ahctf1
Ensembl Gene ENSMUSG00000026491
Gene NameAT hook containing transcription factor 1
Synonyms6230412P20Rik, Elys
MMRRC Submission 044145-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5958 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location179744894-179803680 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 179746542 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027768] [ENSMUST00000131716] [ENSMUST00000211943] [ENSMUST00000221136]
Predicted Effect probably benign
Transcript: ENSMUST00000027768
SMART Domains Protein: ENSMUSP00000027768
Gene: ENSMUSG00000026491

DomainStartEndE-ValueType
Pfam:ELYS-bb 1 489 1.6e-307 PFAM
Pfam:ELYS 722 955 2.5e-58 PFAM
low complexity region 1138 1155 N/A INTRINSIC
low complexity region 1180 1192 N/A INTRINSIC
low complexity region 1352 1366 N/A INTRINSIC
low complexity region 1597 1610 N/A INTRINSIC
low complexity region 1684 1694 N/A INTRINSIC
low complexity region 1834 1841 N/A INTRINSIC
low complexity region 1918 1935 N/A INTRINSIC
AT_hook 1955 1967 3.35e-1 SMART
low complexity region 2060 2066 N/A INTRINSIC
low complexity region 2073 2084 N/A INTRINSIC
low complexity region 2096 2108 N/A INTRINSIC
Blast:KISc 2164 2217 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131716
SMART Domains Protein: ENSMUSP00000118935
Gene: ENSMUSG00000087236

DomainStartEndE-ValueType
KISc 3 331 1.02e-120 SMART
low complexity region 343 354 N/A INTRINSIC
FHA 424 473 1.12e-3 SMART
Pfam:KIF1B 615 654 1.3e-7 PFAM
low complexity region 842 857 N/A INTRINSIC
low complexity region 959 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140489
SMART Domains Protein: ENSMUSP00000115253
Gene: ENSMUSG00000026491

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151734
Predicted Effect probably benign
Transcript: ENSMUST00000211943
Predicted Effect probably benign
Transcript: ENSMUST00000221136
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.0%
Validation Efficiency 95% (75/79)
MGI Phenotype PHENOTYPE: Homozygous null mice die between E3.5 and E5.5. The inner cell mass cells exhibit impaired proliferation and apoptosis when grown in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,041,935 D616G probably damaging Het
Adam30 A G 3: 98,161,964 N243S probably damaging Het
Adck1 A G 12: 88,459,052 I417V probably benign Het
Adcy4 T C 14: 55,779,099 probably null Het
Ap1s3 G T 1: 79,614,243 T130K probably benign Het
Apold1 C T 6: 134,983,723 R47C probably damaging Het
Atp13a5 T C 16: 29,339,042 K197E probably damaging Het
Camk2d T G 3: 126,779,865 probably benign Het
Ccin A G 4: 43,983,854 D87G probably damaging Het
Cdan1 T C 2: 120,723,902 T889A possibly damaging Het
Cel T A 2: 28,560,945 Y102F probably damaging Het
Cma1 A C 14: 55,941,656 *248E probably null Het
Cnbd1 T C 4: 18,862,056 N378S probably benign Het
Col18a1 T A 10: 77,096,397 Y533F probably benign Het
Cpb2 T C 14: 75,283,387 I414T probably damaging Het
D430042O09Rik A G 7: 125,813,635 K358E probably benign Het
Dagla T C 19: 10,248,424 Y792C probably damaging Het
Dlgap5 T A 14: 47,413,754 E107D probably damaging Het
Dmtf1 T A 5: 9,122,415 probably benign Het
Dst A G 1: 34,186,050 K1682R probably damaging Het
Epyc A T 10: 97,649,842 H48L probably benign Het
Fam135b A G 15: 71,462,895 S817P probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Foxk1 T C 5: 142,456,674 V693A probably benign Het
Fuom A T 7: 140,099,898 F122I probably damaging Het
Glg1 G T 8: 111,259,104 H31Q probably benign Het
Gm13199 C T 2: 5,862,254 probably benign Het
Hdac9 G T 12: 34,373,883 Q595K probably damaging Het
Homez C T 14: 54,856,841 R119Q probably benign Het
Ifit3b A G 19: 34,611,742 H106R probably benign Het
Ift57 C T 16: 49,711,108 probably benign Het
Itk A T 11: 46,344,855 probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klhdc3 A T 17: 46,675,102 V378D probably benign Het
Klhl14 A G 18: 21,565,535 I407T probably damaging Het
Meioc A T 11: 102,675,153 T476S probably benign Het
Olfm3 G A 3: 115,122,306 V276I probably damaging Het
Olfr1449 T C 19: 12,935,047 F103S probably damaging Het
Pcm1 T C 8: 41,328,979 L1972P probably damaging Het
Pcsk6 A G 7: 66,043,611 E3G probably damaging Het
Pctp A G 11: 89,986,119 S185P probably benign Het
Pik3c2a A G 7: 116,362,564 L1010S probably damaging Het
Pitpnm3 G T 11: 72,112,367 probably null Het
Prrc2b A G 2: 32,212,080 M722V possibly damaging Het
Rad18 T C 6: 112,696,642 probably benign Het
Senp6 T C 9: 80,142,294 S1036P probably damaging Het
Slc22a22 C T 15: 57,263,536 A46T possibly damaging Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Spag6l C A 16: 16,763,021 probably null Het
Strc T C 2: 121,376,922 H656R possibly damaging Het
Tanc2 A G 11: 105,840,625 D409G probably benign Het
Thap11 A G 8: 105,856,064 H235R probably damaging Het
Thsd7a T A 6: 12,337,262 Y1252F probably benign Het
Tlr11 T G 14: 50,360,777 N73K probably damaging Het
Ttll10 T C 4: 156,036,066 probably null Het
Ubr4 A T 4: 139,455,638 N445I probably damaging Het
Ugt1a6a C T 1: 88,215,788 probably benign Het
Urb2 T C 8: 124,029,659 F702L probably benign Het
Utp14b A T 1: 78,664,942 K186* probably null Het
Utp14b A T 1: 78,664,943 K186M probably damaging Het
Vmn2r16 T A 5: 109,362,287 M512K possibly damaging Het
Vmn2r27 T A 6: 124,231,727 M20L probably benign Het
Other mutations in Ahctf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Ahctf1 APN 1 179769131 missense probably damaging 1.00
IGL01714:Ahctf1 APN 1 179795877 missense probably damaging 0.99
IGL01787:Ahctf1 APN 1 179753322 missense probably benign
IGL01997:Ahctf1 APN 1 179755462 missense probably damaging 0.99
IGL02035:Ahctf1 APN 1 179766014 missense probably benign 0.00
IGL02158:Ahctf1 APN 1 179779652 missense possibly damaging 0.64
IGL02182:Ahctf1 APN 1 179753078 missense probably benign 0.00
IGL02298:Ahctf1 APN 1 179752479 missense probably benign 0.00
IGL02325:Ahctf1 APN 1 179776015 missense probably benign 0.14
IGL02619:Ahctf1 APN 1 179792451 missense possibly damaging 0.90
IGL02858:Ahctf1 APN 1 179769034 missense probably damaging 0.96
IGL02893:Ahctf1 APN 1 179776011 nonsense probably null
IGL02895:Ahctf1 APN 1 179793811 missense probably damaging 1.00
IGL03180:Ahctf1 APN 1 179775330 critical splice donor site probably null
IGL03220:Ahctf1 APN 1 179788202 missense probably benign 0.01
cerebro UTSW 1 179769414 missense probably damaging 0.99
R0003:Ahctf1 UTSW 1 179763473 missense probably benign 0.04
R0024:Ahctf1 UTSW 1 179752436 missense probably damaging 0.98
R0030:Ahctf1 UTSW 1 179752436 missense probably damaging 0.98
R0432:Ahctf1 UTSW 1 179784161 missense probably damaging 0.98
R0481:Ahctf1 UTSW 1 179760271 missense probably benign 0.00
R0600:Ahctf1 UTSW 1 179763468 critical splice donor site probably null
R0613:Ahctf1 UTSW 1 179769414 missense probably damaging 0.99
R0814:Ahctf1 UTSW 1 179762908 missense probably benign 0.26
R1055:Ahctf1 UTSW 1 179763486 missense possibly damaging 0.46
R1473:Ahctf1 UTSW 1 179776108 missense probably benign 0.30
R1473:Ahctf1 UTSW 1 179799279 missense probably damaging 0.99
R1689:Ahctf1 UTSW 1 179768383 missense probably damaging 0.96
R1778:Ahctf1 UTSW 1 179753015 missense possibly damaging 0.57
R1878:Ahctf1 UTSW 1 179775509 missense possibly damaging 0.96
R1925:Ahctf1 UTSW 1 179770653 missense probably damaging 0.98
R2118:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2122:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2124:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2373:Ahctf1 UTSW 1 179795796 missense probably damaging 1.00
R2509:Ahctf1 UTSW 1 179770693 missense possibly damaging 0.51
R2697:Ahctf1 UTSW 1 179752532 missense probably damaging 0.99
R3035:Ahctf1 UTSW 1 179753870 missense probably damaging 1.00
R3155:Ahctf1 UTSW 1 179755583 missense probably damaging 0.98
R3899:Ahctf1 UTSW 1 179777780 missense possibly damaging 0.95
R4036:Ahctf1 UTSW 1 179762616 missense possibly damaging 0.61
R4681:Ahctf1 UTSW 1 179752796 missense probably benign 0.27
R4695:Ahctf1 UTSW 1 179753054 missense possibly damaging 0.78
R4735:Ahctf1 UTSW 1 179753399 missense probably benign 0.00
R4857:Ahctf1 UTSW 1 179799357 unclassified probably benign
R4898:Ahctf1 UTSW 1 179755512 missense probably benign 0.02
R4905:Ahctf1 UTSW 1 179748627 missense probably damaging 1.00
R5011:Ahctf1 UTSW 1 179784110 missense possibly damaging 0.92
R5013:Ahctf1 UTSW 1 179784110 missense possibly damaging 0.92
R5053:Ahctf1 UTSW 1 179786784 missense possibly damaging 0.82
R5207:Ahctf1 UTSW 1 179793594 intron probably benign
R5319:Ahctf1 UTSW 1 179769050 missense probably damaging 1.00
R5343:Ahctf1 UTSW 1 179770634 nonsense probably null
R5546:Ahctf1 UTSW 1 179754068 missense probably benign 0.01
R5718:Ahctf1 UTSW 1 179769339 missense possibly damaging 0.54
R5862:Ahctf1 UTSW 1 179788330 missense probably damaging 1.00
R6010:Ahctf1 UTSW 1 179795813 missense possibly damaging 0.80
R6081:Ahctf1 UTSW 1 179781672 missense probably benign 0.07
R6093:Ahctf1 UTSW 1 179762952 missense probably benign 0.01
R6207:Ahctf1 UTSW 1 179777390 intron probably null
R6268:Ahctf1 UTSW 1 179763483 missense probably benign 0.08
R6656:Ahctf1 UTSW 1 179753513 missense probably benign 0.05
R6668:Ahctf1 UTSW 1 179752407 missense probably benign 0.04
R6788:Ahctf1 UTSW 1 179752634 missense probably benign 0.00
R6860:Ahctf1 UTSW 1 179753288 missense probably benign 0.04
R6998:Ahctf1 UTSW 1 179770915 nonsense probably null
R7082:Ahctf1 UTSW 1 179775333 missense probably benign 0.15
R7385:Ahctf1 UTSW 1 179753381 missense possibly damaging 0.66
R7414:Ahctf1 UTSW 1 179784105 missense probably benign 0.00
R7663:Ahctf1 UTSW 1 179790314 missense possibly damaging 0.66
R7673:Ahctf1 UTSW 1 179762846 missense probably benign 0.02
R7715:Ahctf1 UTSW 1 179770848 missense probably benign 0.00
R7819:Ahctf1 UTSW 1 179768315 missense probably benign
R7846:Ahctf1 UTSW 1 179787073 missense probably damaging 0.99
R7912:Ahctf1 UTSW 1 179753091 missense probably benign 0.00
R7929:Ahctf1 UTSW 1 179787073 missense probably damaging 0.99
R7993:Ahctf1 UTSW 1 179753091 missense probably benign 0.00
X0067:Ahctf1 UTSW 1 179777704 missense probably damaging 0.99
Z1177:Ahctf1 UTSW 1 179793730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGTGCGTGTTAAAATCTTGG -3'
(R):5'- TGGGCCATCCTTGTAACTGC -3'

Sequencing Primer
(F):5'- CAGCATTTTCCTGCGTAAAATTTGC -3'
(R):5'- GCAGAATTTTAGACATATCTGTGGC -3'
Posted On2017-03-31