Incidental Mutation 'R5958:Strc'
ID471268
Institutional Source Beutler Lab
Gene Symbol Strc
Ensembl Gene ENSMUSG00000033498
Gene Namestereocilin
SynonymsDFNB16
MMRRC Submission 044145-MU
Accession Numbers

Genbank: NM_080459; MGI: 2153816

Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R5958 (G1)
Quality Score216
Status Validated
Chromosome2
Chromosomal Location121363728-121387168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121376922 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 656 (H656R)
Ref Sequence ENSEMBL: ENSMUSP00000039378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038389
AA Change: H656R

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: H656R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129136
SMART Domains Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150332
Meta Mutation Damage Score 0.3235 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.0%
Validation Efficiency 95% (75/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,041,935 D616G probably damaging Het
Adam30 A G 3: 98,161,964 N243S probably damaging Het
Adck1 A G 12: 88,459,052 I417V probably benign Het
Adcy4 T C 14: 55,779,099 probably null Het
Ahctf1 A G 1: 179,746,542 probably benign Het
Ap1s3 G T 1: 79,614,243 T130K probably benign Het
Apold1 C T 6: 134,983,723 R47C probably damaging Het
Atp13a5 T C 16: 29,339,042 K197E probably damaging Het
Camk2d T G 3: 126,779,865 probably benign Het
Ccin A G 4: 43,983,854 D87G probably damaging Het
Cdan1 T C 2: 120,723,902 T889A possibly damaging Het
Cel T A 2: 28,560,945 Y102F probably damaging Het
Cma1 A C 14: 55,941,656 *248E probably null Het
Cnbd1 T C 4: 18,862,056 N378S probably benign Het
Col18a1 T A 10: 77,096,397 Y533F probably benign Het
Cpb2 T C 14: 75,283,387 I414T probably damaging Het
D430042O09Rik A G 7: 125,813,635 K358E probably benign Het
Dagla T C 19: 10,248,424 Y792C probably damaging Het
Dlgap5 T A 14: 47,413,754 E107D probably damaging Het
Dmtf1 T A 5: 9,122,415 probably benign Het
Dst A G 1: 34,186,050 K1682R probably damaging Het
Epyc A T 10: 97,649,842 H48L probably benign Het
Fam135b A G 15: 71,462,895 S817P probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Foxk1 T C 5: 142,456,674 V693A probably benign Het
Fuom A T 7: 140,099,898 F122I probably damaging Het
Glg1 G T 8: 111,259,104 H31Q probably benign Het
Gm13199 C T 2: 5,862,254 probably benign Het
Hdac9 G T 12: 34,373,883 Q595K probably damaging Het
Homez C T 14: 54,856,841 R119Q probably benign Het
Ifit3b A G 19: 34,611,742 H106R probably benign Het
Ift57 C T 16: 49,711,108 probably benign Het
Itk A T 11: 46,344,855 probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klhdc3 A T 17: 46,675,102 V378D probably benign Het
Klhl14 A G 18: 21,565,535 I407T probably damaging Het
Meioc A T 11: 102,675,153 T476S probably benign Het
Olfm3 G A 3: 115,122,306 V276I probably damaging Het
Olfr1449 T C 19: 12,935,047 F103S probably damaging Het
Pcm1 T C 8: 41,328,979 L1972P probably damaging Het
Pcsk6 A G 7: 66,043,611 E3G probably damaging Het
Pctp A G 11: 89,986,119 S185P probably benign Het
Pik3c2a A G 7: 116,362,564 L1010S probably damaging Het
Pitpnm3 G T 11: 72,112,367 probably null Het
Prrc2b A G 2: 32,212,080 M722V possibly damaging Het
Rad18 T C 6: 112,696,642 probably benign Het
Senp6 T C 9: 80,142,294 S1036P probably damaging Het
Slc22a22 C T 15: 57,263,536 A46T possibly damaging Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Spag6l C A 16: 16,763,021 probably null Het
Tanc2 A G 11: 105,840,625 D409G probably benign Het
Thap11 A G 8: 105,856,064 H235R probably damaging Het
Thsd7a T A 6: 12,337,262 Y1252F probably benign Het
Tlr11 T G 14: 50,360,777 N73K probably damaging Het
Ttll10 T C 4: 156,036,066 probably null Het
Ubr4 A T 4: 139,455,638 N445I probably damaging Het
Ugt1a6a C T 1: 88,215,788 probably benign Het
Urb2 T C 8: 124,029,659 F702L probably benign Het
Utp14b A T 1: 78,664,942 K186* probably null Het
Utp14b A T 1: 78,664,943 K186M probably damaging Het
Vmn2r16 T A 5: 109,362,287 M512K possibly damaging Het
Vmn2r27 T A 6: 124,231,727 M20L probably benign Het
Other mutations in Strc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Strc APN 2 121365060 missense probably benign 0.39
IGL01152:Strc APN 2 121370795 missense probably benign
IGL01608:Strc APN 2 121375594 missense probably benign 0.05
IGL01695:Strc APN 2 121375298 missense probably damaging 1.00
IGL01715:Strc APN 2 121365737 splice site probably null
IGL01906:Strc APN 2 121377634 missense probably benign
IGL02135:Strc APN 2 121364834 missense probably damaging 1.00
IGL02416:Strc APN 2 121369058 missense probably damaging 1.00
IGL02455:Strc APN 2 121375791 unclassified probably benign
IGL03029:Strc APN 2 121364044 missense possibly damaging 0.95
IGL03176:Strc APN 2 121372180 missense probably damaging 0.99
IGL03272:Strc APN 2 121371751 missense probably damaging 1.00
3-1:Strc UTSW 2 121373680 missense probably damaging 0.99
IGL02799:Strc UTSW 2 121379236 missense probably damaging 1.00
PIT4283001:Strc UTSW 2 121375307 missense probably damaging 1.00
R0022:Strc UTSW 2 121368393 missense probably damaging 1.00
R0494:Strc UTSW 2 121379533 missense probably damaging 0.99
R1065:Strc UTSW 2 121366651 missense probably damaging 1.00
R1148:Strc UTSW 2 121372077 intron probably benign
R1148:Strc UTSW 2 121372077 intron probably benign
R1203:Strc UTSW 2 121372123 missense possibly damaging 0.66
R1343:Strc UTSW 2 121365115 missense probably benign 0.21
R1544:Strc UTSW 2 121372738 splice site probably null
R1650:Strc UTSW 2 121380885 start gained probably benign
R1840:Strc UTSW 2 121379296 missense probably damaging 1.00
R1983:Strc UTSW 2 121371037 missense possibly damaging 0.54
R2035:Strc UTSW 2 121374934 missense probably damaging 1.00
R2058:Strc UTSW 2 121378887 missense probably damaging 1.00
R2158:Strc UTSW 2 121365862 missense probably benign 0.10
R2219:Strc UTSW 2 121364523 missense probably damaging 1.00
R2680:Strc UTSW 2 121365111 missense probably damaging 0.99
R4375:Strc UTSW 2 121380823 missense unknown
R4563:Strc UTSW 2 121365805 missense probably benign 0.02
R4578:Strc UTSW 2 121378003 missense possibly damaging 0.94
R4607:Strc UTSW 2 121372945 missense probably benign 0.31
R4651:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4652:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4790:Strc UTSW 2 121375594 missense probably benign 0.05
R5480:Strc UTSW 2 121364819 missense probably benign 0.00
R5580:Strc UTSW 2 121375012 missense probably damaging 0.99
R5679:Strc UTSW 2 121368100 missense probably benign 0.03
R5703:Strc UTSW 2 121370814 missense probably benign
R5841:Strc UTSW 2 121365877 missense probably benign 0.29
R5917:Strc UTSW 2 121379309 missense probably benign
R6320:Strc UTSW 2 121374958 missense probably benign 0.16
R6619:Strc UTSW 2 121368432 missense probably damaging 0.99
R6695:Strc UTSW 2 121377224 missense probably benign 0.35
R6970:Strc UTSW 2 121378014 missense probably benign 0.41
R7018:Strc UTSW 2 121369058 missense probably damaging 1.00
R7045:Strc UTSW 2 121370726 missense probably damaging 1.00
R7190:Strc UTSW 2 121369026 missense probably benign 0.14
R7283:Strc UTSW 2 121379452 missense probably damaging 0.99
R7694:Strc UTSW 2 121377096 missense probably damaging 1.00
R7699:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7700:Strc UTSW 2 121371748 missense possibly damaging 0.47
R7756:Strc UTSW 2 121370946 missense probably benign
R7758:Strc UTSW 2 121370946 missense probably benign
R7822:Strc UTSW 2 121377738 missense probably benign 0.01
R7830:Strc UTSW 2 121375049 missense probably damaging 0.99
R7953:Strc UTSW 2 121377363 missense probably damaging 0.99
R8137:Strc UTSW 2 121366738 missense probably damaging 0.98
R8394:Strc UTSW 2 121379009 missense probably benign 0.00
R8427:Strc UTSW 2 121377531 missense probably damaging 1.00
Z1176:Strc UTSW 2 121375521 missense probably damaging 0.98
Z1176:Strc UTSW 2 121379044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACTCTCCGACTGTCCTCAG -3'
(R):5'- GAAGCCTTGGTTCCCTTCTG -3'

Sequencing Primer
(F):5'- GTCCTCAGTACACTTCTCCGG -3'
(R):5'- CAGGCCAATGCAGAATTAGTC -3'
Posted On2017-03-31