Incidental Mutation 'R5958:Itk'
ID471296
Institutional Source Beutler Lab
Gene Symbol Itk
Ensembl Gene ENSMUSG00000020395
Gene NameIL2 inducible T cell kinase
SynonymsEmt, Tsk, Tcsk
MMRRC Submission 044145-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5958 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location46325150-46389515 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 46344855 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020664] [ENSMUST00000101306] [ENSMUST00000109237]
PDB Structure
INTRAMOLECULAR ITK-PROLINE COMPLEX, NMR, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
NMR Structures of Itk SH2 domain, Pro287cis isoform, ensemble of 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287cis, Energy minimized average structure [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, energy minimized average structure [SOLUTION NMR]
The NMR minimized average structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
The NMR ensemble structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
Solution Structure of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase [SOLUTION NMR]
Ensemble Structures of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase. [SOLUTION NMR]
NMR structure note: murine Itk SH3 domain [SOLUTION NMR]
>> 2 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000020664
SMART Domains Protein: ENSMUSP00000020664
Gene: ENSMUSG00000020395

DomainStartEndE-ValueType
PH 5 113 2.3e-13 SMART
BTK 113 149 1.1e-21 SMART
SH3 174 230 5.87e-14 SMART
SH2 237 328 9.44e-29 SMART
TyrKc 362 611 3.28e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101306
SMART Domains Protein: ENSMUSP00000098864
Gene: ENSMUSG00000020395

DomainStartEndE-ValueType
PH 5 113 2.3e-13 SMART
BTK 113 149 1.1e-21 SMART
SH3 174 230 5.87e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109237
SMART Domains Protein: ENSMUSP00000104860
Gene: ENSMUSG00000020395

DomainStartEndE-ValueType
PH 5 119 3.94e-12 SMART
BTK 119 155 1.1e-21 SMART
SH3 180 236 5.87e-14 SMART
SH2 243 334 9.44e-29 SMART
TyrKc 368 617 3.28e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148132
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.0%
Validation Efficiency 95% (75/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular tyrosine kinase expressed in T-cells. The protein contains both SH2 and SH3 domains which are often found in intracellular kinases. It is thought to play a role in T-cell proliferation and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased percentages of CD4 and CD8 cells, increased percentage of B cells, impaired T cell receptor signaling, and increased susceptibility to Toxoplasma gondii infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,041,935 D616G probably damaging Het
Adam30 A G 3: 98,161,964 N243S probably damaging Het
Adck1 A G 12: 88,459,052 I417V probably benign Het
Adcy4 T C 14: 55,779,099 probably null Het
Ahctf1 A G 1: 179,746,542 probably benign Het
Ap1s3 G T 1: 79,614,243 T130K probably benign Het
Apold1 C T 6: 134,983,723 R47C probably damaging Het
Atp13a5 T C 16: 29,339,042 K197E probably damaging Het
Camk2d T G 3: 126,779,865 probably benign Het
Ccin A G 4: 43,983,854 D87G probably damaging Het
Cdan1 T C 2: 120,723,902 T889A possibly damaging Het
Cel T A 2: 28,560,945 Y102F probably damaging Het
Cma1 A C 14: 55,941,656 *248E probably null Het
Cnbd1 T C 4: 18,862,056 N378S probably benign Het
Col18a1 T A 10: 77,096,397 Y533F probably benign Het
Cpb2 T C 14: 75,283,387 I414T probably damaging Het
D430042O09Rik A G 7: 125,813,635 K358E probably benign Het
Dagla T C 19: 10,248,424 Y792C probably damaging Het
Dlgap5 T A 14: 47,413,754 E107D probably damaging Het
Dmtf1 T A 5: 9,122,415 probably benign Het
Dst A G 1: 34,186,050 K1682R probably damaging Het
Epyc A T 10: 97,649,842 H48L probably benign Het
Fam135b A G 15: 71,462,895 S817P probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Foxk1 T C 5: 142,456,674 V693A probably benign Het
Fuom A T 7: 140,099,898 F122I probably damaging Het
Glg1 G T 8: 111,259,104 H31Q probably benign Het
Gm13199 C T 2: 5,862,254 probably benign Het
Hdac9 G T 12: 34,373,883 Q595K probably damaging Het
Homez C T 14: 54,856,841 R119Q probably benign Het
Ifit3b A G 19: 34,611,742 H106R probably benign Het
Ift57 C T 16: 49,711,108 probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klhdc3 A T 17: 46,675,102 V378D probably benign Het
Klhl14 A G 18: 21,565,535 I407T probably damaging Het
Meioc A T 11: 102,675,153 T476S probably benign Het
Olfm3 G A 3: 115,122,306 V276I probably damaging Het
Olfr1449 T C 19: 12,935,047 F103S probably damaging Het
Pcm1 T C 8: 41,328,979 L1972P probably damaging Het
Pcsk6 A G 7: 66,043,611 E3G probably damaging Het
Pctp A G 11: 89,986,119 S185P probably benign Het
Pik3c2a A G 7: 116,362,564 L1010S probably damaging Het
Pitpnm3 G T 11: 72,112,367 probably null Het
Prrc2b A G 2: 32,212,080 M722V possibly damaging Het
Rad18 T C 6: 112,696,642 probably benign Het
Senp6 T C 9: 80,142,294 S1036P probably damaging Het
Slc22a22 C T 15: 57,263,536 A46T possibly damaging Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Spag6l C A 16: 16,763,021 probably null Het
Strc T C 2: 121,376,922 H656R possibly damaging Het
Tanc2 A G 11: 105,840,625 D409G probably benign Het
Thap11 A G 8: 105,856,064 H235R probably damaging Het
Thsd7a T A 6: 12,337,262 Y1252F probably benign Het
Tlr11 T G 14: 50,360,777 N73K probably damaging Het
Ttll10 T C 4: 156,036,066 probably null Het
Ubr4 A T 4: 139,455,638 N445I probably damaging Het
Ugt1a6a C T 1: 88,215,788 probably benign Het
Urb2 T C 8: 124,029,659 F702L probably benign Het
Utp14b A T 1: 78,664,942 K186* probably null Het
Utp14b A T 1: 78,664,943 K186M probably damaging Het
Vmn2r16 T A 5: 109,362,287 M512K possibly damaging Het
Vmn2r27 T A 6: 124,231,727 M20L probably benign Het
Other mutations in Itk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Itk APN 11 46367896 missense probably damaging 1.00
IGL01349:Itk APN 11 46341200 missense possibly damaging 0.84
IGL03290:Itk APN 11 46334937 missense probably damaging 1.00
IGL03385:Itk APN 11 46331861 nonsense probably null
goodnow UTSW 11 46338099 splice site probably null
itxaro UTSW 11 46338217 missense probably damaging 1.00
R0095:Itk UTSW 11 46342452 missense probably damaging 0.99
R0265:Itk UTSW 11 46389458 start gained probably benign
R0281:Itk UTSW 11 46353916 missense probably damaging 1.00
R0463:Itk UTSW 11 46331989 missense probably damaging 1.00
R0518:Itk UTSW 11 46360288 missense probably damaging 0.98
R0521:Itk UTSW 11 46360288 missense probably damaging 0.98
R1121:Itk UTSW 11 46331894 missense possibly damaging 0.93
R1550:Itk UTSW 11 46389326 missense probably damaging 1.00
R1762:Itk UTSW 11 46336482 missense probably damaging 0.98
R2418:Itk UTSW 11 46338217 missense probably damaging 1.00
R2419:Itk UTSW 11 46338217 missense probably damaging 1.00
R2859:Itk UTSW 11 46344835 intron probably benign
R3107:Itk UTSW 11 46327464 missense probably benign 0.15
R3546:Itk UTSW 11 46355848 missense probably benign 0.00
R4601:Itk UTSW 11 46336515 missense probably benign 0.17
R4610:Itk UTSW 11 46336515 missense probably benign 0.17
R4792:Itk UTSW 11 46344831 intron probably benign
R4885:Itk UTSW 11 46336344 splice site probably null
R4934:Itk UTSW 11 46389325 missense probably damaging 1.00
R5286:Itk UTSW 11 46338099 splice site probably null
R5328:Itk UTSW 11 46331876 missense probably benign 0.04
R5399:Itk UTSW 11 46338111 missense probably benign 0.44
R6235:Itk UTSW 11 46336428 missense probably benign 0.16
R6828:Itk UTSW 11 46341218 missense probably damaging 1.00
R6849:Itk UTSW 11 46331935 missense probably damaging 1.00
R7356:Itk UTSW 11 46367832 missense possibly damaging 0.72
R7753:Itk UTSW 11 46331895 missense probably damaging 1.00
U24488:Itk UTSW 11 46338144 missense probably damaging 1.00
X0062:Itk UTSW 11 46366044 missense probably benign 0.15
Z1088:Itk UTSW 11 46353862 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTGAGGCCACATCACTGATC -3'
(R):5'- AGATTTCCCCTCTACAAAGTCAG -3'

Sequencing Primer
(F):5'- ACTGATCCACGTTCTGAAGG -3'
(R):5'- CTACAAAGTCAGCTTTTCTGTACAG -3'
Posted On2017-03-31