Incidental Mutation 'R5958:Hdac9'
ID471303
Institutional Source Beutler Lab
Gene Symbol Hdac9
Ensembl Gene ENSMUSG00000004698
Gene Namehistone deacetylase 9
SynonymsHdac7b, HDRP, Mitr, D030072B18Rik
MMRRC Submission 044145-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5958 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location34047580-34917095 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34373883 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 595 (Q595K)
Ref Sequence ENSEMBL: ENSMUSP00000148224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110819] [ENSMUST00000209667] [ENSMUST00000209750] [ENSMUST00000209902] [ENSMUST00000209990] [ENSMUST00000210724] [ENSMUST00000211107] [ENSMUST00000211752]
Predicted Effect probably benign
Transcript: ENSMUST00000110819
AA Change: Q571K

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106443
Gene: ENSMUSG00000004698
AA Change: Q571K

DomainStartEndE-ValueType
Pfam:HDAC4_Gln 37 124 5.4e-36 PFAM
low complexity region 260 284 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209667
AA Change: Q527K

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably damaging
Transcript: ENSMUST00000209750
AA Change: Q574K

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000209902
AA Change: Q571K

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209990
AA Change: Q530K

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000210724
Predicted Effect probably benign
Transcript: ENSMUST00000211107
AA Change: Q543K

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably damaging
Transcript: ENSMUST00000211752
AA Change: Q595K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Meta Mutation Damage Score 0.0859 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.0%
Validation Efficiency 95% (75/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to the Xenopus and mouse MITR genes. The MITR protein lacks the histone deacetylase catalytic domain. It represses MEF2 activity through recruitment of multicomponent corepressor complexes that include CtBP and HDACs. This encoded protein may play a role in hematopoiesis. Multiple alternatively spliced transcripts have been described for this gene but the full-length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display age dependent cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,041,935 D616G probably damaging Het
Adam30 A G 3: 98,161,964 N243S probably damaging Het
Adck1 A G 12: 88,459,052 I417V probably benign Het
Adcy4 T C 14: 55,779,099 probably null Het
Ahctf1 A G 1: 179,746,542 probably benign Het
Ap1s3 G T 1: 79,614,243 T130K probably benign Het
Apold1 C T 6: 134,983,723 R47C probably damaging Het
Atp13a5 T C 16: 29,339,042 K197E probably damaging Het
Camk2d T G 3: 126,779,865 probably benign Het
Ccin A G 4: 43,983,854 D87G probably damaging Het
Cdan1 T C 2: 120,723,902 T889A possibly damaging Het
Cel T A 2: 28,560,945 Y102F probably damaging Het
Cma1 A C 14: 55,941,656 *248E probably null Het
Cnbd1 T C 4: 18,862,056 N378S probably benign Het
Col18a1 T A 10: 77,096,397 Y533F probably benign Het
Cpb2 T C 14: 75,283,387 I414T probably damaging Het
D430042O09Rik A G 7: 125,813,635 K358E probably benign Het
Dagla T C 19: 10,248,424 Y792C probably damaging Het
Dlgap5 T A 14: 47,413,754 E107D probably damaging Het
Dmtf1 T A 5: 9,122,415 probably benign Het
Dst A G 1: 34,186,050 K1682R probably damaging Het
Epyc A T 10: 97,649,842 H48L probably benign Het
Fam135b A G 15: 71,462,895 S817P probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Foxk1 T C 5: 142,456,674 V693A probably benign Het
Fuom A T 7: 140,099,898 F122I probably damaging Het
Glg1 G T 8: 111,259,104 H31Q probably benign Het
Gm13199 C T 2: 5,862,254 probably benign Het
Homez C T 14: 54,856,841 R119Q probably benign Het
Ifit3b A G 19: 34,611,742 H106R probably benign Het
Ift57 C T 16: 49,711,108 probably benign Het
Itk A T 11: 46,344,855 probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klhdc3 A T 17: 46,675,102 V378D probably benign Het
Klhl14 A G 18: 21,565,535 I407T probably damaging Het
Meioc A T 11: 102,675,153 T476S probably benign Het
Olfm3 G A 3: 115,122,306 V276I probably damaging Het
Olfr1449 T C 19: 12,935,047 F103S probably damaging Het
Pcm1 T C 8: 41,328,979 L1972P probably damaging Het
Pcsk6 A G 7: 66,043,611 E3G probably damaging Het
Pctp A G 11: 89,986,119 S185P probably benign Het
Pik3c2a A G 7: 116,362,564 L1010S probably damaging Het
Pitpnm3 G T 11: 72,112,367 probably null Het
Prrc2b A G 2: 32,212,080 M722V possibly damaging Het
Rad18 T C 6: 112,696,642 probably benign Het
Senp6 T C 9: 80,142,294 S1036P probably damaging Het
Slc22a22 C T 15: 57,263,536 A46T possibly damaging Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Spag6l C A 16: 16,763,021 probably null Het
Strc T C 2: 121,376,922 H656R possibly damaging Het
Tanc2 A G 11: 105,840,625 D409G probably benign Het
Thap11 A G 8: 105,856,064 H235R probably damaging Het
Thsd7a T A 6: 12,337,262 Y1252F probably benign Het
Tlr11 T G 14: 50,360,777 N73K probably damaging Het
Ttll10 T C 4: 156,036,066 probably null Het
Ubr4 A T 4: 139,455,638 N445I probably damaging Het
Ugt1a6a C T 1: 88,215,788 probably benign Het
Urb2 T C 8: 124,029,659 F702L probably benign Het
Utp14b A T 1: 78,664,942 K186* probably null Het
Utp14b A T 1: 78,664,943 K186M probably damaging Het
Vmn2r16 T A 5: 109,362,287 M512K possibly damaging Het
Vmn2r27 T A 6: 124,231,727 M20L probably benign Het
Other mutations in Hdac9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Hdac9 APN 12 34429489 splice site probably benign
IGL01484:Hdac9 APN 12 34437165 missense probably damaging 1.00
IGL02010:Hdac9 APN 12 34431945 missense probably damaging 1.00
IGL02059:Hdac9 APN 12 34431968 missense probably damaging 0.97
IGL02276:Hdac9 APN 12 34431926 missense probably damaging 1.00
IGL02797:Hdac9 APN 12 34393274 splice site probably benign
IGL03202:Hdac9 APN 12 34373951 missense probably damaging 1.00
PIT4468001:Hdac9 UTSW 12 34095934 missense unknown
R0304:Hdac9 UTSW 12 34374111 missense probably damaging 1.00
R0432:Hdac9 UTSW 12 34437222 missense probably damaging 1.00
R0659:Hdac9 UTSW 12 34437222 missense probably damaging 1.00
R1826:Hdac9 UTSW 12 34429492 splice site probably benign
R1879:Hdac9 UTSW 12 34390333 missense probably damaging 0.98
R1942:Hdac9 UTSW 12 34429545 missense probably damaging 1.00
R2113:Hdac9 UTSW 12 34389332 missense probably damaging 1.00
R2151:Hdac9 UTSW 12 34390256 missense probably damaging 1.00
R2216:Hdac9 UTSW 12 34429517 missense probably damaging 1.00
R2224:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R2225:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R2227:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R3500:Hdac9 UTSW 12 34437353 missense probably benign 0.01
R4441:Hdac9 UTSW 12 34389376 missense probably damaging 1.00
R4674:Hdac9 UTSW 12 34373960 missense possibly damaging 0.96
R4694:Hdac9 UTSW 12 34437247 missense probably damaging 1.00
R5033:Hdac9 UTSW 12 34373907 missense probably benign
R5229:Hdac9 UTSW 12 34437164 missense probably damaging 1.00
R5353:Hdac9 UTSW 12 34393393 nonsense probably null
R5384:Hdac9 UTSW 12 34429558 missense probably damaging 1.00
R6129:Hdac9 UTSW 12 34287475 missense probably damaging 1.00
R6157:Hdac9 UTSW 12 34389429 missense probably damaging 1.00
R6248:Hdac9 UTSW 12 34528294 missense possibly damaging 0.79
R6333:Hdac9 UTSW 12 34052324 missense probably damaging 0.98
R6474:Hdac9 UTSW 12 34431991 critical splice acceptor site probably null
R6589:Hdac9 UTSW 12 34215029 missense probably damaging 1.00
R6737:Hdac9 UTSW 12 34215452 missense probably damaging 1.00
R6767:Hdac9 UTSW 12 34287529 missense probably damaging 1.00
R6837:Hdac9 UTSW 12 34287464 missense probably benign 0.12
R6857:Hdac9 UTSW 12 34393363 missense probably benign 0.37
R7069:Hdac9 UTSW 12 34429549 missense possibly damaging 0.92
R7237:Hdac9 UTSW 12 34374140 critical splice acceptor site probably null
R7768:Hdac9 UTSW 12 34390240 missense possibly damaging 0.81
Z1088:Hdac9 UTSW 12 34407789 missense probably damaging 1.00
Z1176:Hdac9 UTSW 12 34373987 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCATTTTCTTACCAGTGAAGG -3'
(R):5'- AGACAGAGCAGCCTCTAAGG -3'

Sequencing Primer
(F):5'- GAAGGTTCAATGAATCCTGATACCC -3'
(R):5'- CCTCTAAGGACAACAGTGCTAGG -3'
Posted On2017-03-31