Incidental Mutation 'R5958:Olfr1449'
ID471320
Institutional Source Beutler Lab
Gene Symbol Olfr1449
Ensembl Gene ENSMUSG00000049498
Gene Nameolfactory receptor 1449
SynonymsGA_x6K02T2RE5P-3264213-3265157, MOR202-34
MMRRC Submission 044145-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5958 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12930840-12935752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12935047 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 103 (F103S)
Ref Sequence ENSEMBL: ENSMUSP00000148934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056005] [ENSMUST00000208624] [ENSMUST00000214079] [ENSMUST00000215325]
Predicted Effect probably damaging
Transcript: ENSMUST00000056005
AA Change: F103S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056181
Gene: ENSMUSG00000049498
AA Change: F103S

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 4.5e-53 PFAM
Pfam:7tm_1 42 290 3.7e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208624
AA Change: F103S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000214079
AA Change: F103S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215325
AA Change: F103S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.3121 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.0%
Validation Efficiency 95% (75/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,041,935 D616G probably damaging Het
Adam30 A G 3: 98,161,964 N243S probably damaging Het
Adck1 A G 12: 88,459,052 I417V probably benign Het
Adcy4 T C 14: 55,779,099 probably null Het
Ahctf1 A G 1: 179,746,542 probably benign Het
Ap1s3 G T 1: 79,614,243 T130K probably benign Het
Apold1 C T 6: 134,983,723 R47C probably damaging Het
Atp13a5 T C 16: 29,339,042 K197E probably damaging Het
Camk2d T G 3: 126,779,865 probably benign Het
Ccin A G 4: 43,983,854 D87G probably damaging Het
Cdan1 T C 2: 120,723,902 T889A possibly damaging Het
Cel T A 2: 28,560,945 Y102F probably damaging Het
Cma1 A C 14: 55,941,656 *248E probably null Het
Cnbd1 T C 4: 18,862,056 N378S probably benign Het
Col18a1 T A 10: 77,096,397 Y533F probably benign Het
Cpb2 T C 14: 75,283,387 I414T probably damaging Het
D430042O09Rik A G 7: 125,813,635 K358E probably benign Het
Dagla T C 19: 10,248,424 Y792C probably damaging Het
Dlgap5 T A 14: 47,413,754 E107D probably damaging Het
Dmtf1 T A 5: 9,122,415 probably benign Het
Dst A G 1: 34,186,050 K1682R probably damaging Het
Epyc A T 10: 97,649,842 H48L probably benign Het
Fam135b A G 15: 71,462,895 S817P probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Foxk1 T C 5: 142,456,674 V693A probably benign Het
Fuom A T 7: 140,099,898 F122I probably damaging Het
Glg1 G T 8: 111,259,104 H31Q probably benign Het
Gm13199 C T 2: 5,862,254 probably benign Het
Hdac9 G T 12: 34,373,883 Q595K probably damaging Het
Homez C T 14: 54,856,841 R119Q probably benign Het
Ifit3b A G 19: 34,611,742 H106R probably benign Het
Ift57 C T 16: 49,711,108 probably benign Het
Itk A T 11: 46,344,855 probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klhdc3 A T 17: 46,675,102 V378D probably benign Het
Klhl14 A G 18: 21,565,535 I407T probably damaging Het
Meioc A T 11: 102,675,153 T476S probably benign Het
Olfm3 G A 3: 115,122,306 V276I probably damaging Het
Pcm1 T C 8: 41,328,979 L1972P probably damaging Het
Pcsk6 A G 7: 66,043,611 E3G probably damaging Het
Pctp A G 11: 89,986,119 S185P probably benign Het
Pik3c2a A G 7: 116,362,564 L1010S probably damaging Het
Pitpnm3 G T 11: 72,112,367 probably null Het
Prrc2b A G 2: 32,212,080 M722V possibly damaging Het
Rad18 T C 6: 112,696,642 probably benign Het
Senp6 T C 9: 80,142,294 S1036P probably damaging Het
Slc22a22 C T 15: 57,263,536 A46T possibly damaging Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Spag6l C A 16: 16,763,021 probably null Het
Strc T C 2: 121,376,922 H656R possibly damaging Het
Tanc2 A G 11: 105,840,625 D409G probably benign Het
Thap11 A G 8: 105,856,064 H235R probably damaging Het
Thsd7a T A 6: 12,337,262 Y1252F probably benign Het
Tlr11 T G 14: 50,360,777 N73K probably damaging Het
Ttll10 T C 4: 156,036,066 probably null Het
Ubr4 A T 4: 139,455,638 N445I probably damaging Het
Ugt1a6a C T 1: 88,215,788 probably benign Het
Urb2 T C 8: 124,029,659 F702L probably benign Het
Utp14b A T 1: 78,664,942 K186* probably null Het
Utp14b A T 1: 78,664,943 K186M probably damaging Het
Vmn2r16 T A 5: 109,362,287 M512K possibly damaging Het
Vmn2r27 T A 6: 124,231,727 M20L probably benign Het
Other mutations in Olfr1449
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Olfr1449 APN 19 12935562 missense probably damaging 0.98
IGL01943:Olfr1449 APN 19 12935674 missense probably benign 0.24
IGL02966:Olfr1449 APN 19 12934800 missense probably benign 0.08
IGL02974:Olfr1449 APN 19 12935035 missense probably benign 0.02
IGL03220:Olfr1449 APN 19 12935494 missense probably damaging 1.00
PIT4531001:Olfr1449 UTSW 19 12935277 missense probably damaging 0.98
R0285:Olfr1449 UTSW 19 12935172 missense probably benign 0.00
R0573:Olfr1449 UTSW 19 12935260 missense possibly damaging 0.77
R0588:Olfr1449 UTSW 19 12934747 missense probably benign 0.00
R0726:Olfr1449 UTSW 19 12935605 missense probably damaging 1.00
R1006:Olfr1449 UTSW 19 12935274 missense probably damaging 1.00
R1146:Olfr1449 UTSW 19 12934965 missense possibly damaging 0.77
R1146:Olfr1449 UTSW 19 12934965 missense possibly damaging 0.77
R1386:Olfr1449 UTSW 19 12935139 missense probably benign 0.17
R1735:Olfr1449 UTSW 19 12934843 missense probably damaging 1.00
R1794:Olfr1449 UTSW 19 12934968 missense probably damaging 0.97
R2355:Olfr1449 UTSW 19 12935019 missense possibly damaging 0.91
R2511:Olfr1449 UTSW 19 12935173 missense possibly damaging 0.85
R4673:Olfr1449 UTSW 19 12935097 missense probably damaging 1.00
R4749:Olfr1449 UTSW 19 12935217 missense probably benign 0.02
R4765:Olfr1449 UTSW 19 12935076 missense possibly damaging 0.65
R5112:Olfr1449 UTSW 19 12934816 missense probably benign 0.01
R6115:Olfr1449 UTSW 19 12935584 missense possibly damaging 0.54
R6152:Olfr1449 UTSW 19 12935487 missense probably benign 0.13
R6417:Olfr1449 UTSW 19 12935220 missense probably damaging 1.00
R6420:Olfr1449 UTSW 19 12935220 missense probably damaging 1.00
R6695:Olfr1449 UTSW 19 12935400 missense possibly damaging 0.95
R6963:Olfr1449 UTSW 19 12935638 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGGAATCTGGGCATTATCG -3'
(R):5'- AACCACATTAGCACAGTAGGGG -3'

Sequencing Primer
(F):5'- CATTATCGTGTTGATATGGCTGGAC -3'
(R):5'- GTGAATCCAGTATGTATAGCAGACTC -3'
Posted On2017-03-31