Incidental Mutation 'R5959:Cfap61'
ID471330
Institutional Source Beutler Lab
Gene Symbol Cfap61
Ensembl Gene ENSMUSG00000037143
Gene Namecilia and flagella associated protein 61
Synonyms4930529M08Rik
MMRRC Submission 044146-MU
Accession Numbers

Genbank: NM_175280.3; Ensemble: ENSMUST00000133433

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5959 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location145934784-146215039 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 145947133 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 19 (T19M)
Ref Sequence ENSEMBL: ENSMUSP00000120838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116398] [ENSMUST00000118002] [ENSMUST00000126415] [ENSMUST00000130168] [ENSMUST00000133433] [ENSMUST00000138774] [ENSMUST00000152515]
Predicted Effect silent
Transcript: ENSMUST00000116398
SMART Domains Protein: ENSMUSP00000112099
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
SCOP:d1b87a_ 183 237 1e-3 SMART
Predicted Effect silent
Transcript: ENSMUST00000118002
SMART Domains Protein: ENSMUSP00000113529
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
transmembrane domain 133 155 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000126415
SMART Domains Protein: ENSMUSP00000118626
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
SCOP:d1b87a_ 183 244 1e-5 SMART
low complexity region 355 368 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000130168
SMART Domains Protein: ENSMUSP00000121294
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
transmembrane domain 133 155 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000133433
SMART Domains Protein: ENSMUSP00000118411
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
Pfam:DUF4821 15 272 1.1e-96 PFAM
low complexity region 355 368 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 1172 1182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138774
AA Change: T19M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120838
Gene: ENSMUSG00000037143
AA Change: T19M

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
transmembrane domain 49 71 N/A INTRINSIC
SCOP:d1b87a_ 99 153 2e-4 SMART
Predicted Effect silent
Transcript: ENSMUST00000152515
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A T 11: 84,215,966 N164Y probably damaging Het
Acp6 A G 3: 97,166,572 E164G probably damaging Het
Adcy5 A T 16: 35,298,410 I1044F probably damaging Het
Ahcyl2 A G 6: 29,886,174 D363G probably damaging Het
Ankrd28 T C 14: 31,729,922 T273A probably benign Het
Cc2d1a A T 8: 84,133,503 Y862* probably null Het
Cfap221 T A 1: 119,932,781 H705L probably damaging Het
Chga T C 12: 102,561,855 S202P probably benign Het
Cnmd T C 14: 79,656,669 I93V probably damaging Het
Cpne1 G A 2: 156,078,223 S188L probably benign Het
Dchs2 G A 3: 83,325,418 V2237I probably benign Het
Dguok C T 6: 83,490,592 R91H probably benign Het
Eed A G 7: 89,969,627 I193T probably damaging Het
Fasn C T 11: 120,808,564 E2353K probably damaging Het
Fpr-rs7 G A 17: 20,113,749 H160Y probably benign Het
Gm12394 T A 4: 42,793,492 K213N probably damaging Het
Gramd4 T A 15: 86,127,557 M272K probably damaging Het
Hfm1 A G 5: 106,874,917 S940P probably damaging Het
Ifnlr1 T A 4: 135,705,341 S363T possibly damaging Het
Jak3 A G 8: 71,682,071 N481D probably damaging Het
Kcnj3 A G 2: 55,437,318 K40E probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Lpcat4 T A 2: 112,240,035 L31H possibly damaging Het
Myo1c A G 11: 75,657,519 T38A probably benign Het
Myt1l T C 12: 29,920,040 probably null Het
Nbas T C 12: 13,288,801 V214A probably damaging Het
Neb C A 2: 52,156,377 R6537L probably benign Het
Nwd2 T A 5: 63,808,070 F1666I probably benign Het
Olfr67 T A 7: 103,787,516 I254F probably damaging Het
Olfr906 A G 9: 38,488,911 N294S probably damaging Het
Prmt8 C A 6: 127,729,418 V137L probably damaging Het
Ptpn21 A T 12: 98,708,889 probably null Het
Rab15 A G 12: 76,822,269 S17P probably damaging Het
Rbm5 T G 9: 107,752,140 I338L probably benign Het
Rragc G A 4: 123,923,974 S218N probably damaging Het
Sacs T C 14: 61,212,400 M3965T probably damaging Het
Sgo2b T A 8: 63,927,288 I837F probably benign Het
Sorcs3 T G 19: 48,749,396 C751G probably damaging Het
Sowahc A G 10: 59,223,098 D352G probably benign Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tenm3 T A 8: 48,646,447 R108* probably null Het
Traf3ip2 A T 10: 39,641,341 M403L probably benign Het
Trappc11 T C 8: 47,501,558 D949G probably damaging Het
Ttn A G 2: 76,714,616 I32714T probably damaging Het
Ttn T A 2: 76,863,505 T218S possibly damaging Het
Uaca A T 9: 60,870,770 H811L probably damaging Het
Ugt2b1 T C 5: 86,925,954 E182G probably benign Het
Vmn1r49 T C 6: 90,072,804 D72G probably damaging Het
Vmn2r80 A T 10: 79,169,479 M317L probably benign Het
Vwa2 T C 19: 56,881,172 L13P possibly damaging Het
Zc3hav1 G A 6: 38,307,444 T912I probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp948 A G 17: 21,587,514 K323E probably benign Het
Zfyve27 T G 19: 42,179,448 V143G unknown Het
Other mutations in Cfap61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02838:Cfap61 APN 2 145947164 nonsense probably null
IGL03024:Cfap61 APN 2 145939999 splice site probably benign
1mM(1):Cfap61 UTSW 2 146200760 missense probably damaging 1.00
R0006:Cfap61 UTSW 2 146077312 missense probably benign 0.06
R0396:Cfap61 UTSW 2 145949944 missense possibly damaging 0.88
R0458:Cfap61 UTSW 2 146008917 missense probably benign 0.08
R0477:Cfap61 UTSW 2 145939916 missense probably damaging 1.00
R0513:Cfap61 UTSW 2 146035295 missense possibly damaging 0.93
R1104:Cfap61 UTSW 2 145951061 nonsense probably null
R1413:Cfap61 UTSW 2 145963443 missense probably benign 0.27
R1591:Cfap61 UTSW 2 146145458 missense probably benign 0.17
R1599:Cfap61 UTSW 2 146012163 missense probably benign
R1661:Cfap61 UTSW 2 146035319 splice site probably null
R1665:Cfap61 UTSW 2 146035319 splice site probably null
R1789:Cfap61 UTSW 2 145939993 critical splice donor site probably null
R1800:Cfap61 UTSW 2 146042622 missense probably damaging 1.00
R2050:Cfap61 UTSW 2 146145473 missense probably benign 0.26
R2202:Cfap61 UTSW 2 146214680 missense probably damaging 1.00
R2220:Cfap61 UTSW 2 146036816 critical splice acceptor site probably null
R2444:Cfap61 UTSW 2 146035319 splice site probably null
R3779:Cfap61 UTSW 2 145950794 missense probably damaging 1.00
R4668:Cfap61 UTSW 2 146143136 missense probably damaging 0.99
R4705:Cfap61 UTSW 2 146035202 missense probably damaging 1.00
R4763:Cfap61 UTSW 2 146017367 missense probably benign 0.00
R4816:Cfap61 UTSW 2 146143100 missense probably damaging 1.00
R5067:Cfap61 UTSW 2 146102036 missense probably damaging 0.99
R5120:Cfap61 UTSW 2 146143160 nonsense probably null
R5308:Cfap61 UTSW 2 146109988 missense probably damaging 0.99
R5575:Cfap61 UTSW 2 146017393 missense probably benign 0.31
R5834:Cfap61 UTSW 2 146129149 missense probably benign 0.29
R6190:Cfap61 UTSW 2 145947133 missense probably benign 0.00
R6283:Cfap61 UTSW 2 146129102 unclassified probably null
R6786:Cfap61 UTSW 2 146045443 missense possibly damaging 0.84
R6933:Cfap61 UTSW 2 145951050 splice site probably null
R7071:Cfap61 UTSW 2 146001912 missense probably benign 0.02
R7132:Cfap61 UTSW 2 146109950 missense probably damaging 0.97
R7312:Cfap61 UTSW 2 146045470 nonsense probably null
R7390:Cfap61 UTSW 2 146001882 missense probably benign 0.00
R7446:Cfap61 UTSW 2 146153838 missense probably benign 0.00
R7515:Cfap61 UTSW 2 146042725 missense unknown
X0022:Cfap61 UTSW 2 146129090 missense probably benign 0.28
Z1088:Cfap61 UTSW 2 146129227 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AGCACAGCCTAACTTTCAGC -3'
(R):5'- TGCATCAGTTGGGGTTCTCAAC -3'

Sequencing Primer
(F):5'- TAATGGGCAGCAGCAGGTCC -3'
(R):5'- GGTTCTCAACCCAGAAACTGACTG -3'
Posted On2017-03-31