Incidental Mutation 'R5959:Olfr906'
ID471356
Institutional Source Beutler Lab
Gene Symbol Olfr906
Ensembl Gene ENSMUSG00000039962
Gene Nameolfactory receptor 906
SynonymsMOR167-2, GA_x6K02T2PVTD-32194085-32195020
MMRRC Submission 044146-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5959 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38487085-38491560 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38488911 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 294 (N294S)
Ref Sequence ENSEMBL: ENSMUSP00000151008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045493] [ENSMUST00000214344]
Predicted Effect probably damaging
Transcript: ENSMUST00000045493
AA Change: N294S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039040
Gene: ENSMUSG00000039962
AA Change: N294S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.6e-50 PFAM
Pfam:7tm_1 41 290 2.1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214344
AA Change: N294S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A T 11: 84,215,966 N164Y probably damaging Het
Acp6 A G 3: 97,166,572 E164G probably damaging Het
Adcy5 A T 16: 35,298,410 I1044F probably damaging Het
Ahcyl2 A G 6: 29,886,174 D363G probably damaging Het
Ankrd28 T C 14: 31,729,922 T273A probably benign Het
Cc2d1a A T 8: 84,133,503 Y862* probably null Het
Cfap221 T A 1: 119,932,781 H705L probably damaging Het
Cfap61 C T 2: 145,947,133 T19M probably benign Het
Chga T C 12: 102,561,855 S202P probably benign Het
Cnmd T C 14: 79,656,669 I93V probably damaging Het
Cpne1 G A 2: 156,078,223 S188L probably benign Het
Dchs2 G A 3: 83,325,418 V2237I probably benign Het
Dguok C T 6: 83,490,592 R91H probably benign Het
Eed A G 7: 89,969,627 I193T probably damaging Het
Fasn C T 11: 120,808,564 E2353K probably damaging Het
Fpr-rs7 G A 17: 20,113,749 H160Y probably benign Het
Gm12394 T A 4: 42,793,492 K213N probably damaging Het
Gramd4 T A 15: 86,127,557 M272K probably damaging Het
Hfm1 A G 5: 106,874,917 S940P probably damaging Het
Ifnlr1 T A 4: 135,705,341 S363T possibly damaging Het
Jak3 A G 8: 71,682,071 N481D probably damaging Het
Kcnj3 A G 2: 55,437,318 K40E probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Lpcat4 T A 2: 112,240,035 L31H possibly damaging Het
Myo1c A G 11: 75,657,519 T38A probably benign Het
Myt1l T C 12: 29,920,040 probably null Het
Nbas T C 12: 13,288,801 V214A probably damaging Het
Neb C A 2: 52,156,377 R6537L probably benign Het
Nwd2 T A 5: 63,808,070 F1666I probably benign Het
Olfr67 T A 7: 103,787,516 I254F probably damaging Het
Prmt8 C A 6: 127,729,418 V137L probably damaging Het
Ptpn21 A T 12: 98,708,889 probably null Het
Rab15 A G 12: 76,822,269 S17P probably damaging Het
Rbm5 T G 9: 107,752,140 I338L probably benign Het
Rragc G A 4: 123,923,974 S218N probably damaging Het
Sacs T C 14: 61,212,400 M3965T probably damaging Het
Sgo2b T A 8: 63,927,288 I837F probably benign Het
Sorcs3 T G 19: 48,749,396 C751G probably damaging Het
Sowahc A G 10: 59,223,098 D352G probably benign Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tenm3 T A 8: 48,646,447 R108* probably null Het
Traf3ip2 A T 10: 39,641,341 M403L probably benign Het
Trappc11 T C 8: 47,501,558 D949G probably damaging Het
Ttn A G 2: 76,714,616 I32714T probably damaging Het
Ttn T A 2: 76,863,505 T218S possibly damaging Het
Uaca A T 9: 60,870,770 H811L probably damaging Het
Ugt2b1 T C 5: 86,925,954 E182G probably benign Het
Vmn1r49 T C 6: 90,072,804 D72G probably damaging Het
Vmn2r80 A T 10: 79,169,479 M317L probably benign Het
Vwa2 T C 19: 56,881,172 L13P possibly damaging Het
Zc3hav1 G A 6: 38,307,444 T912I probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp948 A G 17: 21,587,514 K323E probably benign Het
Zfyve27 T G 19: 42,179,448 V143G unknown Het
Other mutations in Olfr906
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03127:Olfr906 APN 9 38488586 missense probably benign 0.13
R0948:Olfr906 UTSW 9 38488948 missense probably benign 0.00
R1236:Olfr906 UTSW 9 38488229 missense probably damaging 1.00
R1246:Olfr906 UTSW 9 38488790 missense probably damaging 1.00
R1442:Olfr906 UTSW 9 38488643 missense probably benign 0.10
R2016:Olfr906 UTSW 9 38488013 critical splice acceptor site probably null
R2264:Olfr906 UTSW 9 38488055 missense possibly damaging 0.50
R2268:Olfr906 UTSW 9 38488208 missense probably damaging 1.00
R3853:Olfr906 UTSW 9 38488951 missense probably benign 0.18
R4066:Olfr906 UTSW 9 38488482 missense probably benign 0.17
R4594:Olfr906 UTSW 9 38488761 missense probably damaging 0.98
R5192:Olfr906 UTSW 9 38488805 missense possibly damaging 0.69
R5436:Olfr906 UTSW 9 38488539 missense probably benign 0.31
R5598:Olfr906 UTSW 9 38488525 missense possibly damaging 0.77
R5694:Olfr906 UTSW 9 38488236 missense probably damaging 1.00
R5914:Olfr906 UTSW 9 38488361 missense probably damaging 1.00
R6318:Olfr906 UTSW 9 38488377 missense probably benign
R6870:Olfr906 UTSW 9 38488086 missense probably benign 0.19
R7482:Olfr906 UTSW 9 38488451 missense probably damaging 0.99
R7571:Olfr906 UTSW 9 38488656 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATCAACTCCAATGAGGGCAG -3'
(R):5'- AGGTAGACATAGTCTCATTTGTGAG -3'

Sequencing Primer
(F):5'- CTCCAATGAGGGCAGGTCCAAG -3'
(R):5'- GCAAAATTTCATCTCAGCATTCG -3'
Posted On2017-03-31