Incidental Mutation 'R5959:Myo1c'
ID471364
Institutional Source Beutler Lab
Gene Symbol Myo1c
Ensembl Gene ENSMUSG00000017774
Gene Namemyosin IC
SynonymsC80397, myosin-Ibeta, myr2, mm1beta
MMRRC Submission 044146-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.678) question?
Stock #R5959 (G1)
Quality Score197
Status Not validated
Chromosome11
Chromosomal Location75650504-75673910 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75657519 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 38 (T38A)
Ref Sequence ENSEMBL: ENSMUSP00000121267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069057] [ENSMUST00000102504] [ENSMUST00000102505] [ENSMUST00000108431] [ENSMUST00000136935]
Predicted Effect probably benign
Transcript: ENSMUST00000069057
SMART Domains Protein: ENSMUSP00000070388
Gene: ENSMUSG00000017774

DomainStartEndE-ValueType
MYSc 5 697 N/A SMART
IQ 698 720 3.85e-3 SMART
IQ 721 743 2.09e-4 SMART
Blast:MYSc 751 780 5e-9 BLAST
low complexity region 804 815 N/A INTRINSIC
Pfam:Myosin_TH1 838 1024 1.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102504
SMART Domains Protein: ENSMUSP00000099562
Gene: ENSMUSG00000017774

DomainStartEndE-ValueType
MYSc 5 697 N/A SMART
IQ 698 720 3.85e-3 SMART
IQ 721 743 2.09e-4 SMART
Blast:MYSc 751 780 5e-9 BLAST
low complexity region 804 815 N/A INTRINSIC
Pfam:Myosin_TH1 838 1024 1.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102505
AA Change: T35A

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099563
Gene: ENSMUSG00000017774
AA Change: T35A

DomainStartEndE-ValueType
MYSc 40 732 N/A SMART
IQ 733 755 3.85e-3 SMART
IQ 756 778 2.09e-4 SMART
Blast:MYSc 786 815 6e-9 BLAST
low complexity region 839 850 N/A INTRINSIC
Pfam:Myosin_TH1 874 1052 2.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108431
AA Change: T16A

PolyPhen 2 Score 0.256 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104069
Gene: ENSMUSG00000017774
AA Change: T16A

DomainStartEndE-ValueType
MYSc 21 713 N/A SMART
IQ 714 736 3.85e-3 SMART
IQ 737 759 2.09e-4 SMART
Blast:MYSc 767 796 5e-9 BLAST
low complexity region 820 831 N/A INTRINSIC
Pfam:Myosin_TH1 854 1040 3.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136935
AA Change: T38A

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121267
Gene: ENSMUSG00000017774
AA Change: T38A

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
PDB:4BYF|C 39 80 5e-21 PDB
Blast:MYSc 43 80 9e-19 BLAST
SCOP:d1lkxa_ 50 80 3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151174
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the unconventional myosin protein family, which are actin-based molecular motors. The protein is found in the cytoplasm, and one isoform with a unique N-terminus is also found in the nucleus. The protein functions in intracellular vesicle transport to the plasma membrane. The nuclear isoform associates with RNA polymerase I and II and functions in transcription initiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in (Y61G) mutation that sensitizes to N6-modified ADP analogs display altered fast adaption in vestibular hair cells. Mice homozygous for a nuclear isoform-specifc knock-out allele exhibit minor changes in bone marrow density and red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A T 11: 84,215,966 N164Y probably damaging Het
Acp6 A G 3: 97,166,572 E164G probably damaging Het
Adcy5 A T 16: 35,298,410 I1044F probably damaging Het
Ahcyl2 A G 6: 29,886,174 D363G probably damaging Het
Ankrd28 T C 14: 31,729,922 T273A probably benign Het
Cc2d1a A T 8: 84,133,503 Y862* probably null Het
Cfap221 T A 1: 119,932,781 H705L probably damaging Het
Cfap61 C T 2: 145,947,133 T19M probably benign Het
Chga T C 12: 102,561,855 S202P probably benign Het
Cnmd T C 14: 79,656,669 I93V probably damaging Het
Cpne1 G A 2: 156,078,223 S188L probably benign Het
Dchs2 G A 3: 83,325,418 V2237I probably benign Het
Dguok C T 6: 83,490,592 R91H probably benign Het
Eed A G 7: 89,969,627 I193T probably damaging Het
Fasn C T 11: 120,808,564 E2353K probably damaging Het
Fpr-rs7 G A 17: 20,113,749 H160Y probably benign Het
Gm12394 T A 4: 42,793,492 K213N probably damaging Het
Gramd4 T A 15: 86,127,557 M272K probably damaging Het
Hfm1 A G 5: 106,874,917 S940P probably damaging Het
Ifnlr1 T A 4: 135,705,341 S363T possibly damaging Het
Jak3 A G 8: 71,682,071 N481D probably damaging Het
Kcnj3 A G 2: 55,437,318 K40E probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Lpcat4 T A 2: 112,240,035 L31H possibly damaging Het
Myt1l T C 12: 29,920,040 probably null Het
Nbas T C 12: 13,288,801 V214A probably damaging Het
Neb C A 2: 52,156,377 R6537L probably benign Het
Nwd2 T A 5: 63,808,070 F1666I probably benign Het
Olfr67 T A 7: 103,787,516 I254F probably damaging Het
Olfr906 A G 9: 38,488,911 N294S probably damaging Het
Prmt8 C A 6: 127,729,418 V137L probably damaging Het
Ptpn21 A T 12: 98,708,889 probably null Het
Rab15 A G 12: 76,822,269 S17P probably damaging Het
Rbm5 T G 9: 107,752,140 I338L probably benign Het
Rragc G A 4: 123,923,974 S218N probably damaging Het
Sacs T C 14: 61,212,400 M3965T probably damaging Het
Sgo2b T A 8: 63,927,288 I837F probably benign Het
Sorcs3 T G 19: 48,749,396 C751G probably damaging Het
Sowahc A G 10: 59,223,098 D352G probably benign Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tenm3 T A 8: 48,646,447 R108* probably null Het
Traf3ip2 A T 10: 39,641,341 M403L probably benign Het
Trappc11 T C 8: 47,501,558 D949G probably damaging Het
Ttn A G 2: 76,714,616 I32714T probably damaging Het
Ttn T A 2: 76,863,505 T218S possibly damaging Het
Uaca A T 9: 60,870,770 H811L probably damaging Het
Ugt2b1 T C 5: 86,925,954 E182G probably benign Het
Vmn1r49 T C 6: 90,072,804 D72G probably damaging Het
Vmn2r80 A T 10: 79,169,479 M317L probably benign Het
Vwa2 T C 19: 56,881,172 L13P possibly damaging Het
Zc3hav1 G A 6: 38,307,444 T912I probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp948 A G 17: 21,587,514 K323E probably benign Het
Zfyve27 T G 19: 42,179,448 V143G unknown Het
Other mutations in Myo1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Myo1c APN 11 75672250 missense probably damaging 1.00
IGL02054:Myo1c APN 11 75661136 missense probably benign 0.30
IGL02115:Myo1c APN 11 75661591 missense probably damaging 0.99
IGL02375:Myo1c APN 11 75661574 missense probably benign 0.00
IGL02878:Myo1c APN 11 75669033 missense possibly damaging 0.93
IGL03008:Myo1c APN 11 75658414 missense probably benign 0.13
Sweeper UTSW 11 75670030 nonsense probably null
R0070:Myo1c UTSW 11 75660250 missense probably benign 0.39
R0070:Myo1c UTSW 11 75660250 missense probably benign 0.39
R0138:Myo1c UTSW 11 75661001 missense possibly damaging 0.92
R0200:Myo1c UTSW 11 75672182 missense probably benign 0.00
R0227:Myo1c UTSW 11 75658694 missense probably benign 0.34
R0257:Myo1c UTSW 11 75665516 critical splice acceptor site probably null
R0513:Myo1c UTSW 11 75665831 splice site probably null
R0587:Myo1c UTSW 11 75657790 missense probably damaging 1.00
R0667:Myo1c UTSW 11 75668512 missense probably damaging 1.00
R1469:Myo1c UTSW 11 75669961 missense probably damaging 1.00
R1469:Myo1c UTSW 11 75669961 missense probably damaging 1.00
R1793:Myo1c UTSW 11 75657589 missense probably damaging 0.98
R1922:Myo1c UTSW 11 75668229 missense probably benign
R2000:Myo1c UTSW 11 75670579 missense probably damaging 1.00
R3983:Myo1c UTSW 11 75661499 missense probably benign 0.05
R4583:Myo1c UTSW 11 75671862 missense possibly damaging 0.72
R4599:Myo1c UTSW 11 75668193 missense probably damaging 0.99
R4671:Myo1c UTSW 11 75670030 nonsense probably null
R4682:Myo1c UTSW 11 75670030 nonsense probably null
R4708:Myo1c UTSW 11 75670030 nonsense probably null
R4709:Myo1c UTSW 11 75670030 nonsense probably null
R4742:Myo1c UTSW 11 75670030 nonsense probably null
R4770:Myo1c UTSW 11 75660313 nonsense probably null
R4888:Myo1c UTSW 11 75669227 missense probably damaging 1.00
R4915:Myo1c UTSW 11 75656309 start codon destroyed probably null
R4934:Myo1c UTSW 11 75671850 missense probably damaging 1.00
R4971:Myo1c UTSW 11 75671588 missense probably damaging 1.00
R5319:Myo1c UTSW 11 75662026 missense possibly damaging 0.95
R5589:Myo1c UTSW 11 75657588 missense possibly damaging 0.74
R5624:Myo1c UTSW 11 75662635 missense probably damaging 0.99
R5756:Myo1c UTSW 11 75658414 missense probably benign 0.42
R6160:Myo1c UTSW 11 75650742 missense probably benign 0.00
R6559:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6568:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6569:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6574:Myo1c UTSW 11 75656298 start gained probably benign
R6579:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6580:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6583:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6640:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6642:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6643:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6679:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6680:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6687:Myo1c UTSW 11 75672201 missense probably benign
R6695:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6696:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6700:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6712:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6713:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6715:Myo1c UTSW 11 75671635 missense probably benign 0.42
R7081:Myo1c UTSW 11 75660963 missense probably benign
R7265:Myo1c UTSW 11 75669790 missense possibly damaging 0.89
R7397:Myo1c UTSW 11 75671242 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GGTCCATATGTCCCATAGGGTC -3'
(R):5'- TTCCTGAAGGTTCCTGCTGC -3'

Sequencing Primer
(F):5'- ATAGGGTCTCTTATCTGCATTCCAG -3'
(R):5'- AAGGTTCCTGCTGCCACCTTC -3'
Posted On2017-03-31