Incidental Mutation 'R5959:Fpr-rs7'
ID 471378
Institutional Source Beutler Lab
Gene Symbol Fpr-rs7
Ensembl Gene ENSMUSG00000071276
Gene Name formyl peptide receptor, related sequence 7
Synonyms
MMRRC Submission 044146-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R5959 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 20333472-20334488 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 20334011 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 160 (H160Y)
Ref Sequence ENSEMBL: ENSMUSP00000093297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095637]
AlphaFold Q71MR7
Predicted Effect probably benign
Transcript: ENSMUST00000095637
AA Change: H160Y

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000093297
Gene: ENSMUSG00000071276
AA Change: H160Y

DomainStartEndE-ValueType
Pfam:7tm_1 43 297 1.2e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176711
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A T 11: 84,106,792 (GRCm39) N164Y probably damaging Het
Acp6 A G 3: 97,073,888 (GRCm39) E164G probably damaging Het
Adcy5 A T 16: 35,118,780 (GRCm39) I1044F probably damaging Het
Ahcyl2 A G 6: 29,886,173 (GRCm39) D363G probably damaging Het
Ankrd28 T C 14: 31,451,879 (GRCm39) T273A probably benign Het
Cc2d1a A T 8: 84,860,132 (GRCm39) Y862* probably null Het
Cfap221 T A 1: 119,860,511 (GRCm39) H705L probably damaging Het
Cfap61 C T 2: 145,789,053 (GRCm39) T19M probably benign Het
Chga T C 12: 102,528,114 (GRCm39) S202P probably benign Het
Cnmd T C 14: 79,894,109 (GRCm39) I93V probably damaging Het
Cpne1 G A 2: 155,920,143 (GRCm39) S188L probably benign Het
Dchs2 G A 3: 83,232,725 (GRCm39) V2237I probably benign Het
Dguok C T 6: 83,467,574 (GRCm39) R91H probably benign Het
Eed A G 7: 89,618,835 (GRCm39) I193T probably damaging Het
Fasn C T 11: 120,699,390 (GRCm39) E2353K probably damaging Het
Gramd4 T A 15: 86,011,758 (GRCm39) M272K probably damaging Het
Hfm1 A G 5: 107,022,783 (GRCm39) S940P probably damaging Het
Ifnlr1 T A 4: 135,432,652 (GRCm39) S363T possibly damaging Het
Jak3 A G 8: 72,134,715 (GRCm39) N481D probably damaging Het
Kcnj3 A G 2: 55,327,330 (GRCm39) K40E probably benign Het
Kif20a G A 18: 34,765,468 (GRCm39) A822T probably benign Het
Lpcat4 T A 2: 112,070,380 (GRCm39) L31H possibly damaging Het
Myo1c A G 11: 75,548,345 (GRCm39) T38A probably benign Het
Myt1l T C 12: 29,970,039 (GRCm39) probably null Het
Nbas T C 12: 13,338,802 (GRCm39) V214A probably damaging Het
Neb C A 2: 52,046,389 (GRCm39) R6537L probably benign Het
Nwd2 T A 5: 63,965,413 (GRCm39) F1666I probably benign Het
Or52z1 T A 7: 103,436,723 (GRCm39) I254F probably damaging Het
Or8b1 A G 9: 38,400,207 (GRCm39) N294S probably damaging Het
Prmt8 C A 6: 127,706,381 (GRCm39) V137L probably damaging Het
Ptpn21 A T 12: 98,675,148 (GRCm39) probably null Het
Rab15 A G 12: 76,869,043 (GRCm39) S17P probably damaging Het
Rbm5 T G 9: 107,629,339 (GRCm39) I338L probably benign Het
Rragc G A 4: 123,817,767 (GRCm39) S218N probably damaging Het
Sacs T C 14: 61,449,849 (GRCm39) M3965T probably damaging Het
Sgo2b T A 8: 64,380,322 (GRCm39) I837F probably benign Het
Sorcs3 T G 19: 48,737,835 (GRCm39) C751G probably damaging Het
Sowahc A G 10: 59,058,920 (GRCm39) D352G probably benign Het
Sox15 C T 11: 69,546,556 (GRCm39) R120C probably damaging Het
Spata31f1e T A 4: 42,793,492 (GRCm39) K213N probably damaging Het
Srr A G 11: 74,801,891 (GRCm39) V126A possibly damaging Het
Tenm3 T A 8: 49,099,482 (GRCm39) R108* probably null Het
Traf3ip2 A T 10: 39,517,337 (GRCm39) M403L probably benign Het
Trappc11 T C 8: 47,954,593 (GRCm39) D949G probably damaging Het
Ttn A G 2: 76,544,960 (GRCm39) I32714T probably damaging Het
Ttn T A 2: 76,693,849 (GRCm39) T218S possibly damaging Het
Uaca A T 9: 60,778,052 (GRCm39) H811L probably damaging Het
Ugt2b1 T C 5: 87,073,813 (GRCm39) E182G probably benign Het
Vmn1r49 T C 6: 90,049,786 (GRCm39) D72G probably damaging Het
Vmn2r80 A T 10: 79,005,313 (GRCm39) M317L probably benign Het
Vwa2 T C 19: 56,869,604 (GRCm39) L13P possibly damaging Het
Zc3hav1 G A 6: 38,284,379 (GRCm39) T912I probably benign Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Zfp948 A G 17: 21,807,776 (GRCm39) K323E probably benign Het
Zfyve27 T G 19: 42,167,887 (GRCm39) V143G unknown Het
Other mutations in Fpr-rs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Fpr-rs7 APN 17 20,333,480 (GRCm39) nonsense probably null
IGL01386:Fpr-rs7 APN 17 20,334,454 (GRCm39) missense probably damaging 0.98
IGL02293:Fpr-rs7 APN 17 20,334,232 (GRCm39) missense probably benign 0.01
IGL03303:Fpr-rs7 APN 17 20,334,001 (GRCm39) missense possibly damaging 0.55
R0731:Fpr-rs7 UTSW 17 20,334,116 (GRCm39) missense probably benign 0.00
R0826:Fpr-rs7 UTSW 17 20,333,888 (GRCm39) missense probably benign 0.01
R1439:Fpr-rs7 UTSW 17 20,333,869 (GRCm39) missense probably benign 0.10
R1590:Fpr-rs7 UTSW 17 20,333,678 (GRCm39) missense probably benign 0.05
R1778:Fpr-rs7 UTSW 17 20,334,277 (GRCm39) missense probably damaging 1.00
R4715:Fpr-rs7 UTSW 17 20,333,690 (GRCm39) missense probably benign 0.00
R4744:Fpr-rs7 UTSW 17 20,334,265 (GRCm39) missense probably benign 0.17
R4921:Fpr-rs7 UTSW 17 20,334,082 (GRCm39) missense possibly damaging 0.70
R5540:Fpr-rs7 UTSW 17 20,334,356 (GRCm39) missense probably damaging 1.00
R5677:Fpr-rs7 UTSW 17 20,334,365 (GRCm39) missense probably benign
R6042:Fpr-rs7 UTSW 17 20,333,477 (GRCm39) missense probably benign 0.00
R7921:Fpr-rs7 UTSW 17 20,333,667 (GRCm39) missense probably benign 0.03
R7984:Fpr-rs7 UTSW 17 20,333,671 (GRCm39) missense probably benign 0.01
R8137:Fpr-rs7 UTSW 17 20,334,055 (GRCm39) missense possibly damaging 0.49
R8172:Fpr-rs7 UTSW 17 20,334,443 (GRCm39) missense probably benign 0.04
R8762:Fpr-rs7 UTSW 17 20,333,789 (GRCm39) missense probably benign 0.07
R9134:Fpr-rs7 UTSW 17 20,334,325 (GRCm39) missense probably damaging 1.00
Z1176:Fpr-rs7 UTSW 17 20,333,655 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATCTTGGCAGCCATGAGTCC -3'
(R):5'- CAATTGTCATGAATGGAGAATGGC -3'

Sequencing Primer
(F):5'- TTGGCAGCCATGAGTCCATAGC -3'
(R):5'- GGTTCCTTTGCAAATTTGTTCACATG -3'
Posted On 2017-03-31