Incidental Mutation 'R5959:Kif20a'
ID471380
Institutional Source Beutler Lab
Gene Symbol Kif20a
Ensembl Gene ENSMUSG00000003779
Gene Namekinesin family member 20A
SynonymsRabkinesin-6, Rab6kifl
MMRRC Submission 044146-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5959 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location34624624-34633265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34632415 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 822 (A822T)
Ref Sequence ENSEMBL: ENSMUSP00000130045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025228] [ENSMUST00000133181] [ENSMUST00000166044] [ENSMUST00000167161]
Predicted Effect probably benign
Transcript: ENSMUST00000025228
SMART Domains Protein: ENSMUSP00000025228
Gene: ENSMUSG00000024370

DomainStartEndE-ValueType
Pfam:APC8 22 152 1.9e-42 PFAM
Blast:TPR 175 202 4e-10 BLAST
TPR 263 296 4.21e1 SMART
TPR 331 364 1.74e-4 SMART
TPR 365 398 1.83e-3 SMART
TPR 399 432 1.37e-2 SMART
TPR 433 466 8.97e0 SMART
TPR 510 543 1.82e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133162
Predicted Effect probably benign
Transcript: ENSMUST00000133181
SMART Domains Protein: ENSMUSP00000122420
Gene: ENSMUSG00000024370

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:ANAPC8 28 151 6.9e-31 PFAM
Blast:TPR 175 202 4e-10 BLAST
TPR 263 296 4.21e1 SMART
TPR 331 364 1.74e-4 SMART
TPR 365 398 1.83e-3 SMART
TPR 399 432 1.37e-2 SMART
TPR 433 466 8.97e0 SMART
TPR 510 543 1.82e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155307
Predicted Effect probably benign
Transcript: ENSMUST00000166044
AA Change: A822T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000132659
Gene: ENSMUSG00000003779
AA Change: A822T

DomainStartEndE-ValueType
KISc 61 514 3.95e-141 SMART
coiled coil region 559 760 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167161
AA Change: A822T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000130045
Gene: ENSMUSG00000003779
AA Change: A822T

DomainStartEndE-ValueType
KISc 61 514 3.95e-141 SMART
coiled coil region 559 760 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A T 11: 84,215,966 N164Y probably damaging Het
Acp6 A G 3: 97,166,572 E164G probably damaging Het
Adcy5 A T 16: 35,298,410 I1044F probably damaging Het
Ahcyl2 A G 6: 29,886,174 D363G probably damaging Het
Ankrd28 T C 14: 31,729,922 T273A probably benign Het
Cc2d1a A T 8: 84,133,503 Y862* probably null Het
Cfap221 T A 1: 119,932,781 H705L probably damaging Het
Cfap61 C T 2: 145,947,133 T19M probably benign Het
Chga T C 12: 102,561,855 S202P probably benign Het
Cnmd T C 14: 79,656,669 I93V probably damaging Het
Cpne1 G A 2: 156,078,223 S188L probably benign Het
Dchs2 G A 3: 83,325,418 V2237I probably benign Het
Dguok C T 6: 83,490,592 R91H probably benign Het
Eed A G 7: 89,969,627 I193T probably damaging Het
Fasn C T 11: 120,808,564 E2353K probably damaging Het
Fpr-rs7 G A 17: 20,113,749 H160Y probably benign Het
Gm12394 T A 4: 42,793,492 K213N probably damaging Het
Gramd4 T A 15: 86,127,557 M272K probably damaging Het
Hfm1 A G 5: 106,874,917 S940P probably damaging Het
Ifnlr1 T A 4: 135,705,341 S363T possibly damaging Het
Jak3 A G 8: 71,682,071 N481D probably damaging Het
Kcnj3 A G 2: 55,437,318 K40E probably benign Het
Lpcat4 T A 2: 112,240,035 L31H possibly damaging Het
Myo1c A G 11: 75,657,519 T38A probably benign Het
Myt1l T C 12: 29,920,040 probably null Het
Nbas T C 12: 13,288,801 V214A probably damaging Het
Neb C A 2: 52,156,377 R6537L probably benign Het
Nwd2 T A 5: 63,808,070 F1666I probably benign Het
Olfr67 T A 7: 103,787,516 I254F probably damaging Het
Olfr906 A G 9: 38,488,911 N294S probably damaging Het
Prmt8 C A 6: 127,729,418 V137L probably damaging Het
Ptpn21 A T 12: 98,708,889 probably null Het
Rab15 A G 12: 76,822,269 S17P probably damaging Het
Rbm5 T G 9: 107,752,140 I338L probably benign Het
Rragc G A 4: 123,923,974 S218N probably damaging Het
Sacs T C 14: 61,212,400 M3965T probably damaging Het
Sgo2b T A 8: 63,927,288 I837F probably benign Het
Sorcs3 T G 19: 48,749,396 C751G probably damaging Het
Sowahc A G 10: 59,223,098 D352G probably benign Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Srr A G 11: 74,911,065 V126A possibly damaging Het
Tenm3 T A 8: 48,646,447 R108* probably null Het
Traf3ip2 A T 10: 39,641,341 M403L probably benign Het
Trappc11 T C 8: 47,501,558 D949G probably damaging Het
Ttn A G 2: 76,714,616 I32714T probably damaging Het
Ttn T A 2: 76,863,505 T218S possibly damaging Het
Uaca A T 9: 60,870,770 H811L probably damaging Het
Ugt2b1 T C 5: 86,925,954 E182G probably benign Het
Vmn1r49 T C 6: 90,072,804 D72G probably damaging Het
Vmn2r80 A T 10: 79,169,479 M317L probably benign Het
Vwa2 T C 19: 56,881,172 L13P possibly damaging Het
Zc3hav1 G A 6: 38,307,444 T912I probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp948 A G 17: 21,587,514 K323E probably benign Het
Zfyve27 T G 19: 42,179,448 V143G unknown Het
Other mutations in Kif20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02448:Kif20a APN 18 34628454 missense possibly damaging 0.49
IGL02654:Kif20a APN 18 34632023 missense probably damaging 1.00
IGL02739:Kif20a APN 18 34628943 nonsense probably null
R0600:Kif20a UTSW 18 34629209 missense probably damaging 1.00
R0748:Kif20a UTSW 18 34628188 splice site probably benign
R0856:Kif20a UTSW 18 34631218 missense probably benign
R1278:Kif20a UTSW 18 34626777 missense probably benign 0.00
R1752:Kif20a UTSW 18 34631581 missense possibly damaging 0.82
R2036:Kif20a UTSW 18 34628462 missense possibly damaging 0.91
R2143:Kif20a UTSW 18 34625604 missense possibly damaging 0.55
R2144:Kif20a UTSW 18 34625604 missense possibly damaging 0.55
R4231:Kif20a UTSW 18 34632038 missense probably benign
R4372:Kif20a UTSW 18 34629478 missense probably damaging 1.00
R4426:Kif20a UTSW 18 34631941 missense probably damaging 1.00
R4584:Kif20a UTSW 18 34632611 missense probably damaging 1.00
R5524:Kif20a UTSW 18 34630625 critical splice donor site probably null
R5867:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5869:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5949:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5958:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5967:Kif20a UTSW 18 34630527 missense probably benign 0.10
R5969:Kif20a UTSW 18 34632415 missense probably benign 0.01
R6175:Kif20a UTSW 18 34628146 missense probably damaging 0.98
R6490:Kif20a UTSW 18 34629490 missense possibly damaging 0.84
R6694:Kif20a UTSW 18 34625526 missense probably damaging 0.98
R6866:Kif20a UTSW 18 34628493 missense probably benign 0.10
R7129:Kif20a UTSW 18 34632535 missense probably benign 0.00
R7217:Kif20a UTSW 18 34629560 missense probably benign 0.14
R7397:Kif20a UTSW 18 34627676 missense probably damaging 1.00
X0027:Kif20a UTSW 18 34625530 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCATTTCTCATTGCTAATGGTAC -3'
(R):5'- TTTTGCCAAAGGGAGATTTGAG -3'

Sequencing Primer
(F):5'- GCTAATGGTACCTGATCTCTTAAATG -3'
(R):5'- TTTGAGTAAAGGAGAGTGCCGTG -3'
Posted On2017-03-31