Incidental Mutation 'R5960:Orc1'
ID471395
Institutional Source Beutler Lab
Gene Symbol Orc1
Ensembl Gene ENSMUSG00000028587
Gene Nameorigin recognition complex, subunit 1
SynonymsMmORC1, Orc1l
MMRRC Submission 044147-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5960 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location108579423-108614833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108606298 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 671 (S671P)
Ref Sequence ENSEMBL: ENSMUSP00000099805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102744]
PDB Structure
Structure of free mouse ORC1 BAH domain [X-RAY DIFFRACTION]
Structure of mouse ORC1 BAH domain bound to H4K20me2 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102744
AA Change: S671P

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099805
Gene: ENSMUSG00000028587
AA Change: S671P

DomainStartEndE-ValueType
BAH 44 170 1.88e-31 SMART
low complexity region 394 417 N/A INTRINSIC
AAA 505 656 1e-7 SMART
Cdc6_C 757 837 5.45e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129931
Meta Mutation Damage Score 0.6269 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.9%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is the largest subunit of the ORC complex. While other ORC subunits are stable throughout the cell cycle, the levels of this protein vary during the cell cycle, which has been shown to be controlled by ubiquitin-mediated proteolysis after initiation of DNA replication. This protein is found to be selectively phosphorylated during mitosis. It is also reported to interact with MYST histone acetyltransferase 2 (MyST2/HBO1), a protein involved in control of transcription silencing. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,240,273 R22Q probably damaging Het
4930579F01Rik T C 3: 138,183,767 T30A possibly damaging Het
4931408C20Rik T A 1: 26,683,144 H985L probably benign Het
Adat1 T C 8: 111,982,601 M197V probably benign Het
Alcam T C 16: 52,295,126 T210A probably benign Het
Ankfy1 T A 11: 72,757,352 S886R possibly damaging Het
Atg2a T G 19: 6,254,360 F1136V probably damaging Het
BC049352 T C 9: 45,242,990 Y50H probably damaging Het
Birc6 A T 17: 74,528,765 T72S probably damaging Het
C77080 A G 4: 129,222,072 V933A probably damaging Het
Caskin1 A G 17: 24,498,895 T219A probably benign Het
Catsperg1 A G 7: 29,184,783 probably benign Het
Cdh12 A G 15: 21,492,476 probably null Het
Cfap126 A G 1: 171,125,313 D45G probably damaging Het
Ciz1 C A 2: 32,371,216 Q356K possibly damaging Het
Ckmt1 T A 2: 121,363,577 I407N probably damaging Het
Csmd1 C T 8: 16,071,416 E1756K possibly damaging Het
Cwf19l2 A G 9: 3,411,404 K94E probably benign Het
Cyth1 A G 11: 118,132,367 probably benign Het
Ddx25 A G 9: 35,554,511 probably null Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock3 C A 9: 106,911,355 G138* probably null Het
Fam20a G A 11: 109,675,969 probably benign Het
Fanci A G 7: 79,443,762 T1006A probably damaging Het
Fat1 T C 8: 45,033,368 Y3320H probably damaging Het
Fndc8 A G 11: 82,897,572 D76G probably benign Het
Gm19965 T C 1: 116,821,471 I294T possibly damaging Het
Gm9755 T G 8: 67,515,188 noncoding transcript Het
Iars T C 13: 49,724,637 V879A possibly damaging Het
Ifi209 A T 1: 173,638,816 probably null Het
Itgb2l T C 16: 96,426,259 H528R probably benign Het
Marf1 T C 16: 14,152,417 Q146R probably damaging Het
Megf11 A G 9: 64,660,449 T407A probably benign Het
Mtg1 T C 7: 140,146,993 probably benign Het
Nhsl1 T G 10: 18,526,976 S1317A probably benign Het
Nudt16 A T 9: 105,131,499 C63S possibly damaging Het
Nup107 T C 10: 117,790,010 I49V probably null Het
Olfr1025-ps1 T A 2: 85,918,725 S267T probably benign Het
Olfr645 G T 7: 104,084,353 N242K probably damaging Het
Paox A G 7: 140,132,489 D211G probably benign Het
Pck2 A G 14: 55,548,547 T571A possibly damaging Het
Pigg A G 5: 108,336,294 E469G probably benign Het
Pikfyve C A 1: 65,253,438 Y1349* probably null Het
Prickle2 A G 6: 92,376,305 F783L probably benign Het
Prpf40b G T 15: 99,314,904 R627L probably damaging Het
Rasgrf1 A G 9: 90,021,384 I1217V possibly damaging Het
Rbm26 A T 14: 105,150,315 V457D probably damaging Het
Rex1bd C A 8: 70,506,506 R49L probably null Het
Robo2 A T 16: 73,933,715 L1003Q probably damaging Het
Sacs A G 14: 61,208,695 D2730G probably benign Het
Setd6 T A 8: 95,716,199 L88H probably damaging Het
Sncb A G 13: 54,762,982 probably benign Het
Stard9 A G 2: 120,699,961 E2233G probably benign Het
Susd2 C T 10: 75,639,936 V410I probably damaging Het
Synm A G 7: 67,735,746 S281P probably damaging Het
Syvn1 C T 19: 6,050,568 R330C probably damaging Het
Theg T G 10: 79,585,931 K151T possibly damaging Het
Tiam2 A T 17: 3,438,640 D741V probably benign Het
Tph1 A G 7: 46,662,005 probably null Het
Trav7-5 T A 14: 53,531,249 H91Q probably benign Het
Tymp A T 15: 89,376,575 probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Other mutations in Orc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Orc1 APN 4 108595325 splice site probably benign
IGL00709:Orc1 APN 4 108590778 critical splice donor site probably null
IGL01124:Orc1 APN 4 108588787 splice site probably benign
IGL01514:Orc1 APN 4 108602052 missense probably damaging 0.97
IGL01677:Orc1 APN 4 108604585 missense probably damaging 1.00
IGL01782:Orc1 APN 4 108606268 missense possibly damaging 0.78
IGL01886:Orc1 APN 4 108603957 splice site probably null
IGL01912:Orc1 APN 4 108590744 missense probably damaging 1.00
IGL02057:Orc1 APN 4 108588729 missense possibly damaging 0.53
IGL02155:Orc1 APN 4 108590677 missense probably benign 0.00
IGL02311:Orc1 APN 4 108599974 missense probably benign
IGL02616:Orc1 APN 4 108595479 missense probably benign 0.00
land_lubber UTSW 4 108588687 start codon destroyed probably damaging 0.99
R0012:Orc1 UTSW 4 108595646 critical splice donor site probably null
R0195:Orc1 UTSW 4 108614308 nonsense probably null
R0239:Orc1 UTSW 4 108595646 critical splice donor site probably null
R0239:Orc1 UTSW 4 108595646 critical splice donor site probably null
R0611:Orc1 UTSW 4 108602032 missense probably benign
R1351:Orc1 UTSW 4 108595367 missense probably benign 0.01
R1966:Orc1 UTSW 4 108612217 missense probably damaging 1.00
R2018:Orc1 UTSW 4 108590700 missense possibly damaging 0.95
R2398:Orc1 UTSW 4 108601969 missense possibly damaging 0.68
R3110:Orc1 UTSW 4 108604560 missense probably benign 0.01
R3112:Orc1 UTSW 4 108604560 missense probably benign 0.01
R3712:Orc1 UTSW 4 108604021 missense probably damaging 1.00
R3716:Orc1 UTSW 4 108614459 missense probably damaging 1.00
R3829:Orc1 UTSW 4 108605631 missense probably damaging 1.00
R4282:Orc1 UTSW 4 108606274 missense probably benign 0.18
R4320:Orc1 UTSW 4 108588776 missense probably benign
R4321:Orc1 UTSW 4 108588776 missense probably benign
R4322:Orc1 UTSW 4 108588776 missense probably benign
R4348:Orc1 UTSW 4 108593452 missense probably damaging 0.98
R4562:Orc1 UTSW 4 108602055 critical splice donor site probably null
R4772:Orc1 UTSW 4 108579568 utr 5 prime probably benign
R4914:Orc1 UTSW 4 108604558 missense probably damaging 1.00
R4964:Orc1 UTSW 4 108614473 makesense probably null
R5219:Orc1 UTSW 4 108590769 missense probably damaging 1.00
R5428:Orc1 UTSW 4 108599940 missense probably benign 0.00
R5655:Orc1 UTSW 4 108593439 missense probably benign 0.09
R5693:Orc1 UTSW 4 108613079 missense probably benign 0.01
R5936:Orc1 UTSW 4 108601983 missense probably benign 0.10
R6294:Orc1 UTSW 4 108590670 missense probably benign 0.01
R6504:Orc1 UTSW 4 108590717 missense probably benign 0.15
R6533:Orc1 UTSW 4 108597447 missense probably benign 0.05
R6775:Orc1 UTSW 4 108603455 missense probably damaging 1.00
R7123:Orc1 UTSW 4 108588687 start codon destroyed probably damaging 0.99
R7156:Orc1 UTSW 4 108595459 missense probably benign 0.00
R7327:Orc1 UTSW 4 108588714 missense probably benign 0.01
R7552:Orc1 UTSW 4 108588754 missense probably benign 0.41
R7842:Orc1 UTSW 4 108605547 missense probably benign 0.00
R7925:Orc1 UTSW 4 108605547 missense probably benign 0.00
R7982:Orc1 UTSW 4 108603371 intron probably null
R8033:Orc1 UTSW 4 108605564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAGGTACCCAGGTCAAC -3'
(R):5'- TCCTCGTGGCCTTCTAAAGAATC -3'

Sequencing Primer
(F):5'- GTACCCAGGTCAACTAGGCAG -3'
(R):5'- CAGTAGTTCACAAATTTAGCCCTGGC -3'
Posted On2017-03-31