Incidental Mutation 'R5960:Mtg1'
ID471405
Institutional Source Beutler Lab
Gene Symbol Mtg1
Ensembl Gene ENSMUSG00000039018
Gene Namemitochondrial ribosome-associated GTPase 1
SynonymsGtpbp7, LOC212508
MMRRC Submission 044147-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5960 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140137564-140150786 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 140146993 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000036977] [ENSMUST00000059241]
Predicted Effect probably benign
Transcript: ENSMUST00000036977
SMART Domains Protein: ENSMUSP00000036491
Gene: ENSMUSG00000039018

DomainStartEndE-ValueType
SCOP:d1egaa1 31 129 5e-6 SMART
Pfam:FeoB_N 143 219 3.9e-6 PFAM
Pfam:MMR_HSR1 144 283 2.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059241
SMART Domains Protein: ENSMUSP00000053901
Gene: ENSMUSG00000045733

DomainStartEndE-ValueType
Pfam:Shadoo 19 147 7.2e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150667
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155723
Predicted Effect probably benign
Transcript: ENSMUST00000156791
Predicted Effect probably benign
Transcript: ENSMUST00000211171
Meta Mutation Damage Score 0.0996 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.9%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,240,273 R22Q probably damaging Het
4930579F01Rik T C 3: 138,183,767 T30A possibly damaging Het
4931408C20Rik T A 1: 26,683,144 H985L probably benign Het
Adat1 T C 8: 111,982,601 M197V probably benign Het
Alcam T C 16: 52,295,126 T210A probably benign Het
Ankfy1 T A 11: 72,757,352 S886R possibly damaging Het
Atg2a T G 19: 6,254,360 F1136V probably damaging Het
BC049352 T C 9: 45,242,990 Y50H probably damaging Het
Birc6 A T 17: 74,528,765 T72S probably damaging Het
C77080 A G 4: 129,222,072 V933A probably damaging Het
Caskin1 A G 17: 24,498,895 T219A probably benign Het
Catsperg1 A G 7: 29,184,783 probably benign Het
Cdh12 A G 15: 21,492,476 probably null Het
Cfap126 A G 1: 171,125,313 D45G probably damaging Het
Ciz1 C A 2: 32,371,216 Q356K possibly damaging Het
Ckmt1 T A 2: 121,363,577 I407N probably damaging Het
Csmd1 C T 8: 16,071,416 E1756K possibly damaging Het
Cwf19l2 A G 9: 3,411,404 K94E probably benign Het
Cyth1 A G 11: 118,132,367 probably benign Het
Ddx25 A G 9: 35,554,511 probably null Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock3 C A 9: 106,911,355 G138* probably null Het
Fam20a G A 11: 109,675,969 probably benign Het
Fanci A G 7: 79,443,762 T1006A probably damaging Het
Fat1 T C 8: 45,033,368 Y3320H probably damaging Het
Fndc8 A G 11: 82,897,572 D76G probably benign Het
Gm19965 T C 1: 116,821,471 I294T possibly damaging Het
Gm9755 T G 8: 67,515,188 noncoding transcript Het
Iars T C 13: 49,724,637 V879A possibly damaging Het
Ifi209 A T 1: 173,638,816 probably null Het
Itgb2l T C 16: 96,426,259 H528R probably benign Het
Marf1 T C 16: 14,152,417 Q146R probably damaging Het
Megf11 A G 9: 64,660,449 T407A probably benign Het
Nhsl1 T G 10: 18,526,976 S1317A probably benign Het
Nudt16 A T 9: 105,131,499 C63S possibly damaging Het
Nup107 T C 10: 117,790,010 I49V probably null Het
Olfr1025-ps1 T A 2: 85,918,725 S267T probably benign Het
Olfr645 G T 7: 104,084,353 N242K probably damaging Het
Orc1 T C 4: 108,606,298 S671P possibly damaging Het
Paox A G 7: 140,132,489 D211G probably benign Het
Pck2 A G 14: 55,548,547 T571A possibly damaging Het
Pigg A G 5: 108,336,294 E469G probably benign Het
Pikfyve C A 1: 65,253,438 Y1349* probably null Het
Prickle2 A G 6: 92,376,305 F783L probably benign Het
Prpf40b G T 15: 99,314,904 R627L probably damaging Het
Rasgrf1 A G 9: 90,021,384 I1217V possibly damaging Het
Rbm26 A T 14: 105,150,315 V457D probably damaging Het
Rex1bd C A 8: 70,506,506 R49L probably null Het
Robo2 A T 16: 73,933,715 L1003Q probably damaging Het
Sacs A G 14: 61,208,695 D2730G probably benign Het
Setd6 T A 8: 95,716,199 L88H probably damaging Het
Sncb A G 13: 54,762,982 probably benign Het
Stard9 A G 2: 120,699,961 E2233G probably benign Het
Susd2 C T 10: 75,639,936 V410I probably damaging Het
Synm A G 7: 67,735,746 S281P probably damaging Het
Syvn1 C T 19: 6,050,568 R330C probably damaging Het
Theg T G 10: 79,585,931 K151T possibly damaging Het
Tiam2 A T 17: 3,438,640 D741V probably benign Het
Tph1 A G 7: 46,662,005 probably null Het
Trav7-5 T A 14: 53,531,249 H91Q probably benign Het
Tymp A T 15: 89,376,575 probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Other mutations in Mtg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Mtg1 APN 7 140150236 missense probably benign 0.00
IGL02105:Mtg1 APN 7 140150206 missense probably damaging 1.00
IGL02458:Mtg1 APN 7 140150172 missense probably benign 0.01
IGL02682:Mtg1 APN 7 140144729 splice site probably benign
R0666:Mtg1 UTSW 7 140144344 missense probably benign
R0893:Mtg1 UTSW 7 140149752 missense probably damaging 1.00
R3707:Mtg1 UTSW 7 140149804 missense probably damaging 0.99
R4993:Mtg1 UTSW 7 140140283 missense probably null 1.00
R5810:Mtg1 UTSW 7 140145985 splice site probably null
R5886:Mtg1 UTSW 7 140149865 splice site probably null
R7069:Mtg1 UTSW 7 140143744 missense probably benign 0.00
R7110:Mtg1 UTSW 7 140146866 missense probably benign 0.02
R7492:Mtg1 UTSW 7 140144697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTCCACTGGTATTCTTGC -3'
(R):5'- ACACGCAGCTAATGGAAGCC -3'

Sequencing Primer
(F):5'- GTCCACTGGTATTCTTGCTGGATAC -3'
(R):5'- AATGCCTCCTAGTTGAAGGC -3'
Posted On2017-03-31