Incidental Mutation 'R5960:Susd2'
ID471418
Institutional Source Beutler Lab
Gene Symbol Susd2
Ensembl Gene ENSMUSG00000006342
Gene Namesushi domain containing 2
Synonyms1200011D11Rik
MMRRC Submission 044147-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R5960 (G1)
Quality Score134
Status Validated
Chromosome10
Chromosomal Location75636706-75644008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75639936 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 410 (V410I)
Ref Sequence ENSEMBL: ENSMUSP00000093197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077610] [ENSMUST00000095541]
Predicted Effect probably damaging
Transcript: ENSMUST00000077610
AA Change: V290I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076802
Gene: ENSMUSG00000006342
AA Change: V290I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
AMOP 162 310 4.09e-82 SMART
VWD 313 489 1.9e-19 SMART
CCP 602 655 3.37e-17 SMART
transmembrane domain 663 685 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095541
AA Change: V410I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093197
Gene: ENSMUSG00000006342
AA Change: V410I

DomainStartEndE-ValueType
SO 25 64 4.77e-2 SMART
AMOP 282 430 4.09e-82 SMART
VWD 433 609 1.9e-19 SMART
CCP 722 775 3.37e-17 SMART
transmembrane domain 783 805 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219733
Meta Mutation Damage Score 0.2129 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.9%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,240,273 R22Q probably damaging Het
4930579F01Rik T C 3: 138,183,767 T30A possibly damaging Het
4931408C20Rik T A 1: 26,683,144 H985L probably benign Het
Adat1 T C 8: 111,982,601 M197V probably benign Het
Alcam T C 16: 52,295,126 T210A probably benign Het
Ankfy1 T A 11: 72,757,352 S886R possibly damaging Het
Atg2a T G 19: 6,254,360 F1136V probably damaging Het
BC049352 T C 9: 45,242,990 Y50H probably damaging Het
Birc6 A T 17: 74,528,765 T72S probably damaging Het
C77080 A G 4: 129,222,072 V933A probably damaging Het
Caskin1 A G 17: 24,498,895 T219A probably benign Het
Catsperg1 A G 7: 29,184,783 probably benign Het
Cdh12 A G 15: 21,492,476 probably null Het
Cfap126 A G 1: 171,125,313 D45G probably damaging Het
Ciz1 C A 2: 32,371,216 Q356K possibly damaging Het
Ckmt1 T A 2: 121,363,577 I407N probably damaging Het
Csmd1 C T 8: 16,071,416 E1756K possibly damaging Het
Cwf19l2 A G 9: 3,411,404 K94E probably benign Het
Cyth1 A G 11: 118,132,367 probably benign Het
Ddx25 A G 9: 35,554,511 probably null Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock3 C A 9: 106,911,355 G138* probably null Het
Fam20a G A 11: 109,675,969 probably benign Het
Fanci A G 7: 79,443,762 T1006A probably damaging Het
Fat1 T C 8: 45,033,368 Y3320H probably damaging Het
Fndc8 A G 11: 82,897,572 D76G probably benign Het
Gm19965 T C 1: 116,821,471 I294T possibly damaging Het
Gm9755 T G 8: 67,515,188 noncoding transcript Het
Iars T C 13: 49,724,637 V879A possibly damaging Het
Ifi209 A T 1: 173,638,816 probably null Het
Itgb2l T C 16: 96,426,259 H528R probably benign Het
Marf1 T C 16: 14,152,417 Q146R probably damaging Het
Megf11 A G 9: 64,660,449 T407A probably benign Het
Mtg1 T C 7: 140,146,993 probably benign Het
Nhsl1 T G 10: 18,526,976 S1317A probably benign Het
Nudt16 A T 9: 105,131,499 C63S possibly damaging Het
Nup107 T C 10: 117,790,010 I49V probably null Het
Olfr1025-ps1 T A 2: 85,918,725 S267T probably benign Het
Olfr645 G T 7: 104,084,353 N242K probably damaging Het
Orc1 T C 4: 108,606,298 S671P possibly damaging Het
Paox A G 7: 140,132,489 D211G probably benign Het
Pck2 A G 14: 55,548,547 T571A possibly damaging Het
Pigg A G 5: 108,336,294 E469G probably benign Het
Pikfyve C A 1: 65,253,438 Y1349* probably null Het
Prickle2 A G 6: 92,376,305 F783L probably benign Het
Prpf40b G T 15: 99,314,904 R627L probably damaging Het
Rasgrf1 A G 9: 90,021,384 I1217V possibly damaging Het
Rbm26 A T 14: 105,150,315 V457D probably damaging Het
Rex1bd C A 8: 70,506,506 R49L probably null Het
Robo2 A T 16: 73,933,715 L1003Q probably damaging Het
Sacs A G 14: 61,208,695 D2730G probably benign Het
Setd6 T A 8: 95,716,199 L88H probably damaging Het
Sncb A G 13: 54,762,982 probably benign Het
Stard9 A G 2: 120,699,961 E2233G probably benign Het
Synm A G 7: 67,735,746 S281P probably damaging Het
Syvn1 C T 19: 6,050,568 R330C probably damaging Het
Theg T G 10: 79,585,931 K151T possibly damaging Het
Tiam2 A T 17: 3,438,640 D741V probably benign Het
Tph1 A G 7: 46,662,005 probably null Het
Trav7-5 T A 14: 53,531,249 H91Q probably benign Het
Tymp A T 15: 89,376,575 probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Other mutations in Susd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Susd2 APN 10 75638048 missense probably benign 0.02
IGL00907:Susd2 APN 10 75640931 missense probably benign 0.04
IGL01155:Susd2 APN 10 75640892 missense possibly damaging 0.87
IGL01677:Susd2 APN 10 75639431 missense possibly damaging 0.91
IGL02146:Susd2 APN 10 75638433 missense possibly damaging 0.79
IGL02273:Susd2 APN 10 75640938 missense possibly damaging 0.94
IGL02386:Susd2 APN 10 75640095 missense probably damaging 0.97
IGL02475:Susd2 APN 10 75637499 critical splice donor site probably null
IGL03218:Susd2 APN 10 75642625 missense probably benign
PIT4418001:Susd2 UTSW 10 75638349 missense probably benign 0.24
R0135:Susd2 UTSW 10 75638514 missense probably damaging 1.00
R0396:Susd2 UTSW 10 75639911 missense probably damaging 1.00
R0401:Susd2 UTSW 10 75638603 splice site probably benign
R0608:Susd2 UTSW 10 75638235 missense probably benign 0.45
R0636:Susd2 UTSW 10 75639350 missense probably damaging 1.00
R1470:Susd2 UTSW 10 75638054 missense probably damaging 1.00
R1470:Susd2 UTSW 10 75638054 missense probably damaging 1.00
R1619:Susd2 UTSW 10 75638044 missense possibly damaging 0.66
R1634:Susd2 UTSW 10 75637555 missense probably benign 0.04
R1866:Susd2 UTSW 10 75639732 missense probably damaging 0.98
R4354:Susd2 UTSW 10 75639728 missense probably damaging 0.99
R4451:Susd2 UTSW 10 75639398 missense probably damaging 1.00
R4721:Susd2 UTSW 10 75638130 missense probably benign 0.00
R5546:Susd2 UTSW 10 75642218 missense probably benign 0.01
R5768:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R5769:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R5770:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R5771:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R6152:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R6153:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R6259:Susd2 UTSW 10 75638046 missense probably damaging 1.00
R6291:Susd2 UTSW 10 75637574 missense possibly damaging 0.61
R7106:Susd2 UTSW 10 75638053 missense probably damaging 1.00
R7232:Susd2 UTSW 10 75639851 missense probably damaging 1.00
R7297:Susd2 UTSW 10 75642568 missense probably benign 0.19
R7326:Susd2 UTSW 10 75642565 missense probably benign 0.00
R7905:Susd2 UTSW 10 75639657 nonsense probably null
R7988:Susd2 UTSW 10 75639657 nonsense probably null
X0025:Susd2 UTSW 10 75640572 nonsense probably null
Z1177:Susd2 UTSW 10 75640478 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAAGCTGGTGCCATCAAAGG -3'
(R):5'- ACATTGAACATGGCAGCGTATG -3'

Sequencing Primer
(F):5'- GCAGAAGATCAGGTAGATTTCTTTG -3'
(R):5'- TGTGCAAGCCAGGTGAGCTAC -3'
Posted On2017-03-31