Incidental Mutation 'R5960:Alcam'
ID471438
Institutional Source Beutler Lab
Gene Symbol Alcam
Ensembl Gene ENSMUSG00000022636
Gene Nameactivated leukocyte cell adhesion molecule
SynonymsSC1, BEN, MuSC, DM-GRASP, CD166
MMRRC Submission 044147-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R5960 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location52248996-52454074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52295126 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 210 (T210A)
Ref Sequence ENSEMBL: ENSMUSP00000023312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023312] [ENSMUST00000164728] [ENSMUST00000170035]
Predicted Effect probably benign
Transcript: ENSMUST00000023312
AA Change: T210A

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023312
Gene: ENSMUSG00000022636
AA Change: T210A

DomainStartEndE-ValueType
IG 26 131 8.46e-2 SMART
Pfam:C2-set_2 137 231 5.1e-24 PFAM
IG 255 330 6.35e-6 SMART
IG 339 413 6.26e-5 SMART
Pfam:Ig_3 415 489 3.8e-6 PFAM
transmembrane domain 528 550 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164728
AA Change: T210A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000127141
Gene: ENSMUSG00000022636
AA Change: T210A

DomainStartEndE-ValueType
IG 26 131 8.46e-2 SMART
Pfam:C2-set_2 137 231 1e-22 PFAM
Pfam:Ig_2 147 235 3.8e-2 PFAM
IG 255 330 6.35e-6 SMART
IG 339 413 6.26e-5 SMART
Pfam:Ig_3 415 496 1.9e-7 PFAM
Pfam:Ig_2 415 502 1.5e-6 PFAM
transmembrane domain 528 550 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167115
AA Change: T58A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000130563
Gene: ENSMUSG00000022636
AA Change: T58A

DomainStartEndE-ValueType
Pfam:C2-set_2 1 80 3.6e-21 PFAM
IG 101 175 6.26e-5 SMART
Pfam:Ig_3 177 251 1.7e-6 PFAM
transmembrane domain 290 312 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170035
AA Change: T210A

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000129714
Gene: ENSMUSG00000022636
AA Change: T210A

DomainStartEndE-ValueType
IG 26 131 8.46e-2 SMART
Pfam:C2-set_2 137 231 3.4e-23 PFAM
Pfam:Ig_2 147 235 1.3e-2 PFAM
IG 255 330 6.35e-6 SMART
IG 339 413 6.26e-5 SMART
Pfam:Ig_3 415 491 5.9e-8 PFAM
Pfam:Ig_2 415 502 4.9e-7 PFAM
transmembrane domain 515 537 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
Meta Mutation Damage Score 0.5373 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.9%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes activated leukocyte cell adhesion molecule (ALCAM), also known as CD166 (cluster of differentiation 166), which is a member of a subfamily of immunoglobulin receptors with five immunoglobulin-like domains (VVC2C2C2) in the extracellular domain. This protein binds to T-cell differentiation antigene CD6, and is implicated in the processes of cell adhesion and migration. Multiple alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice display abnormal motor neuron and retinal ganglion cell morphology and retinal dysplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,240,273 R22Q probably damaging Het
4930579F01Rik T C 3: 138,183,767 T30A possibly damaging Het
4931408C20Rik T A 1: 26,683,144 H985L probably benign Het
Adat1 T C 8: 111,982,601 M197V probably benign Het
Ankfy1 T A 11: 72,757,352 S886R possibly damaging Het
Atg2a T G 19: 6,254,360 F1136V probably damaging Het
BC049352 T C 9: 45,242,990 Y50H probably damaging Het
Birc6 A T 17: 74,528,765 T72S probably damaging Het
C77080 A G 4: 129,222,072 V933A probably damaging Het
Caskin1 A G 17: 24,498,895 T219A probably benign Het
Catsperg1 A G 7: 29,184,783 probably benign Het
Cdh12 A G 15: 21,492,476 probably null Het
Cfap126 A G 1: 171,125,313 D45G probably damaging Het
Ciz1 C A 2: 32,371,216 Q356K possibly damaging Het
Ckmt1 T A 2: 121,363,577 I407N probably damaging Het
Csmd1 C T 8: 16,071,416 E1756K possibly damaging Het
Cwf19l2 A G 9: 3,411,404 K94E probably benign Het
Cyth1 A G 11: 118,132,367 probably benign Het
Ddx25 A G 9: 35,554,511 probably null Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock3 C A 9: 106,911,355 G138* probably null Het
Fam20a G A 11: 109,675,969 probably benign Het
Fanci A G 7: 79,443,762 T1006A probably damaging Het
Fat1 T C 8: 45,033,368 Y3320H probably damaging Het
Fndc8 A G 11: 82,897,572 D76G probably benign Het
Gm19965 T C 1: 116,821,471 I294T possibly damaging Het
Gm9755 T G 8: 67,515,188 noncoding transcript Het
Iars T C 13: 49,724,637 V879A possibly damaging Het
Ifi209 A T 1: 173,638,816 probably null Het
Itgb2l T C 16: 96,426,259 H528R probably benign Het
Marf1 T C 16: 14,152,417 Q146R probably damaging Het
Megf11 A G 9: 64,660,449 T407A probably benign Het
Mtg1 T C 7: 140,146,993 probably benign Het
Nhsl1 T G 10: 18,526,976 S1317A probably benign Het
Nudt16 A T 9: 105,131,499 C63S possibly damaging Het
Nup107 T C 10: 117,790,010 I49V probably null Het
Olfr1025-ps1 T A 2: 85,918,725 S267T probably benign Het
Olfr645 G T 7: 104,084,353 N242K probably damaging Het
Orc1 T C 4: 108,606,298 S671P possibly damaging Het
Paox A G 7: 140,132,489 D211G probably benign Het
Pck2 A G 14: 55,548,547 T571A possibly damaging Het
Pigg A G 5: 108,336,294 E469G probably benign Het
Pikfyve C A 1: 65,253,438 Y1349* probably null Het
Prickle2 A G 6: 92,376,305 F783L probably benign Het
Prpf40b G T 15: 99,314,904 R627L probably damaging Het
Rasgrf1 A G 9: 90,021,384 I1217V possibly damaging Het
Rbm26 A T 14: 105,150,315 V457D probably damaging Het
Rex1bd C A 8: 70,506,506 R49L probably null Het
Robo2 A T 16: 73,933,715 L1003Q probably damaging Het
Sacs A G 14: 61,208,695 D2730G probably benign Het
Setd6 T A 8: 95,716,199 L88H probably damaging Het
Sncb A G 13: 54,762,982 probably benign Het
Stard9 A G 2: 120,699,961 E2233G probably benign Het
Susd2 C T 10: 75,639,936 V410I probably damaging Het
Synm A G 7: 67,735,746 S281P probably damaging Het
Syvn1 C T 19: 6,050,568 R330C probably damaging Het
Theg T G 10: 79,585,931 K151T possibly damaging Het
Tiam2 A T 17: 3,438,640 D741V probably benign Het
Tph1 A G 7: 46,662,005 probably null Het
Trav7-5 T A 14: 53,531,249 H91Q probably benign Het
Tymp A T 15: 89,376,575 probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Other mutations in Alcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Alcam APN 16 52295017 splice site probably benign
IGL00737:Alcam APN 16 52253180 missense unknown
IGL01514:Alcam APN 16 52274290 splice site probably benign
IGL01837:Alcam APN 16 52253168 missense probably benign 0.10
IGL02143:Alcam APN 16 52305619 missense probably damaging 0.99
IGL02231:Alcam APN 16 52274050 splice site probably benign
IGL02375:Alcam APN 16 52288936 missense probably benign 0.00
IGL02579:Alcam APN 16 52270772 missense probably damaging 1.00
IGL02678:Alcam APN 16 52274038 missense probably damaging 1.00
IGL02798:Alcam APN 16 52305639 missense probably damaging 1.00
IGL02974:Alcam APN 16 52295716 missense probably benign 0.05
IGL03335:Alcam APN 16 52291003 nonsense probably null
PIT4402001:Alcam UTSW 16 52295134 missense probably damaging 1.00
PIT4651001:Alcam UTSW 16 52295187 missense probably benign
R0282:Alcam UTSW 16 52295741 missense probably damaging 0.99
R0395:Alcam UTSW 16 52309864 missense probably benign 0.42
R0760:Alcam UTSW 16 52295672 missense probably benign 0.32
R0882:Alcam UTSW 16 52253210 missense possibly damaging 0.47
R1433:Alcam UTSW 16 52295752 critical splice acceptor site probably null
R1677:Alcam UTSW 16 52270773 missense probably damaging 1.00
R1751:Alcam UTSW 16 52270714 missense probably damaging 1.00
R1767:Alcam UTSW 16 52270714 missense probably damaging 1.00
R2440:Alcam UTSW 16 52305613 missense probably damaging 1.00
R2963:Alcam UTSW 16 52295041 missense probably benign 0.00
R3410:Alcam UTSW 16 52309898 missense probably null 0.03
R4327:Alcam UTSW 16 52253216 missense possibly damaging 0.62
R4328:Alcam UTSW 16 52253216 missense possibly damaging 0.62
R4888:Alcam UTSW 16 52268813 missense probably benign 0.03
R5088:Alcam UTSW 16 52288927 missense probably damaging 1.00
R5202:Alcam UTSW 16 52274236 missense probably damaging 1.00
R5208:Alcam UTSW 16 52295048 nonsense probably null
R5278:Alcam UTSW 16 52274275 missense probably benign
R5799:Alcam UTSW 16 52309849 missense probably benign 0.28
R5909:Alcam UTSW 16 52290993 missense probably benign
R6194:Alcam UTSW 16 52268398 missense probably damaging 1.00
R6434:Alcam UTSW 16 52288827 intron probably null
R6831:Alcam UTSW 16 52309901 missense probably benign 0.00
R6868:Alcam UTSW 16 52268385 missense probably damaging 1.00
R6930:Alcam UTSW 16 52305655 missense probably benign 0.14
R6957:Alcam UTSW 16 52276894 missense probably damaging 1.00
R7109:Alcam UTSW 16 52276829 missense probably damaging 0.98
R7473:Alcam UTSW 16 52452519 unclassified probably benign
R7562:Alcam UTSW 16 52268823 missense probably benign 0.00
R7568:Alcam UTSW 16 52268386 missense probably damaging 1.00
R7631:Alcam UTSW 16 52288913 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTGTGATAAGGATTGGCAGCAG -3'
(R):5'- TAGAAGGACAAACTCATATCTCAAGGG -3'

Sequencing Primer
(F):5'- ACTGAATGAGGCTTGTGGAG -3'
(R):5'- GACAAACTCATATCTCAAGGGTGTTG -3'
Posted On2017-03-31