Incidental Mutation 'R5972:Accs'
ID471445
Institutional Source Beutler Lab
Gene Symbol Accs
Ensembl Gene ENSMUSG00000040272
Gene Name1-aminocyclopropane-1-carboxylate synthase (non-functional)
Synonyms2610203E10Rik
MMRRC Submission 044155-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5972 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location93833467-93849943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 93839227 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 283 (H283N)
Ref Sequence ENSEMBL: ENSMUSP00000106877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041593] [ENSMUST00000068513] [ENSMUST00000111246] [ENSMUST00000130077]
Predicted Effect probably damaging
Transcript: ENSMUST00000041593
AA Change: H260N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036268
Gene: ENSMUSG00000040272
AA Change: H260N

DomainStartEndE-ValueType
low complexity region 35 43 N/A INTRINSIC
Pfam:Aminotran_1_2 74 448 1.9e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000068513
AA Change: H260N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000065389
Gene: ENSMUSG00000040272
AA Change: H260N

DomainStartEndE-ValueType
low complexity region 35 43 N/A INTRINSIC
Pfam:Aminotran_1_2 74 448 1.9e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111246
AA Change: H283N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106877
Gene: ENSMUSG00000040272
AA Change: H283N

DomainStartEndE-ValueType
low complexity region 58 66 N/A INTRINSIC
Pfam:Aminotran_1_2 97 471 2.1e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128719
Predicted Effect probably benign
Transcript: ENSMUST00000130077
SMART Domains Protein: ENSMUSP00000114687
Gene: ENSMUSG00000040272

DomainStartEndE-ValueType
low complexity region 35 43 N/A INTRINSIC
Pfam:Aminotran_1_2 74 157 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149073
Predicted Effect probably benign
Transcript: ENSMUST00000150666
SMART Domains Protein: ENSMUSP00000119096
Gene: ENSMUSG00000040272

DomainStartEndE-ValueType
SCOP:d1b8ga_ 2 72 7e-9 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,672,085 M305K probably benign Het
Actl6b A T 5: 137,566,556 H283L possibly damaging Het
Adgra1 T C 7: 139,845,667 L32P probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arfgef2 T C 2: 166,891,836 I1672T probably damaging Het
Arntl2 A G 6: 146,809,689 M64V probably damaging Het
Bambi T A 18: 3,512,354 V246E probably damaging Het
BC048679 A G 7: 81,495,731 L29P probably damaging Het
Camk4 T C 18: 33,107,926 L92P probably damaging Het
Ddx11 C A 17: 66,148,090 Q655K probably benign Het
Ddx52 A G 11: 83,953,225 probably null Het
Eps8l3 T C 3: 107,884,447 probably null Het
Erap1 T A 13: 74,662,304 probably null Het
Fam189b T A 3: 89,185,808 V213D probably damaging Het
Flg T A 3: 93,279,542 N100K probably benign Het
Grip2 A T 6: 91,807,281 V13E probably benign Het
Iars T C 13: 49,709,632 V520A possibly damaging Het
Impa1 A G 3: 10,329,004 M1T probably null Het
Ip6k3 T C 17: 27,149,960 T179A possibly damaging Het
Krt83 T A 15: 101,487,586 M302L probably benign Het
Lrp8 T C 4: 107,869,070 Y899H probably damaging Het
Lrpprc A T 17: 84,712,822 I1145N possibly damaging Het
Mapk11 A T 15: 89,144,184 D324E probably benign Het
Melk C T 4: 44,351,007 T516I probably benign Het
Mia2 C T 12: 59,146,937 H130Y probably damaging Het
Mroh5 C T 15: 73,790,719 probably null Het
Ncam1 T C 9: 49,507,529 T824A possibly damaging Het
Neurog1 T C 13: 56,251,398 S179G probably damaging Het
Ntrk2 T A 13: 58,837,819 L79Q probably damaging Het
Patj T A 4: 98,569,053 M46K probably damaging Het
Pdcd6ip T C 9: 113,662,298 K626E probably benign Het
Pdss2 T A 10: 43,298,926 Y143N probably damaging Het
Pkhd1l1 G A 15: 44,545,416 S2433N probably damaging Het
Plekha5 A G 6: 140,572,913 T309A possibly damaging Het
Prdm4 C T 10: 85,907,501 V297M probably damaging Het
Rab15 T C 12: 76,800,603 Y148C probably damaging Het
Ryr3 A T 2: 112,834,064 N1627K probably damaging Het
Scn1a G T 2: 66,351,110 A23E possibly damaging Het
Smtn A T 11: 3,533,486 I30N probably damaging Het
Sympk A G 7: 19,046,824 K751E probably benign Het
Usp24 C T 4: 106,368,067 P632L probably damaging Het
Vmn2r106 A G 17: 20,278,476 I391T probably benign Het
Vmn2r54 G A 7: 12,615,352 P768S probably damaging Het
Vmn2r54 C T 7: 12,635,947 C63Y probably damaging Het
Zfhx3 T G 8: 108,950,851 C2844W possibly damaging Het
Other mutations in Accs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Accs APN 2 93839242 splice site probably benign
IGL02704:Accs APN 2 93842926 missense probably damaging 0.99
IGL02724:Accs APN 2 93845776 missense probably damaging 1.00
IGL02929:Accs APN 2 93844221 missense probably damaging 1.00
PIT4243001:Accs UTSW 2 93841334 missense probably benign
R0043:Accs UTSW 2 93841885 missense probably benign 0.03
R0644:Accs UTSW 2 93839229 missense probably damaging 1.00
R1712:Accs UTSW 2 93848103 missense probably damaging 0.96
R2215:Accs UTSW 2 93841898 missense probably benign 0.00
R4755:Accs UTSW 2 93841337 missense probably damaging 1.00
R4852:Accs UTSW 2 93844260 missense probably damaging 1.00
R4997:Accs UTSW 2 93841883 nonsense probably null
R5287:Accs UTSW 2 93835953 missense probably damaging 1.00
R5556:Accs UTSW 2 93836083 missense probably damaging 1.00
R5760:Accs UTSW 2 93845760 missense probably damaging 1.00
R5942:Accs UTSW 2 93836047 missense probably damaging 1.00
R6820:Accs UTSW 2 93842921 missense probably null 1.00
R7513:Accs UTSW 2 93840092 missense possibly damaging 0.94
R7861:Accs UTSW 2 93835732 makesense probably null
R8038:Accs UTSW 2 93842917 critical splice donor site probably null
Z1177:Accs UTSW 2 93848153 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTGGTCTACCTACCTGAC -3'
(R):5'- TGTGCAGCCTCCCATTTGTG -3'

Sequencing Primer
(F):5'- ACCACCTTGGGTCAAGACAGG -3'
(R):5'- GCCTCCCATTTGTGAAAATATAGACC -3'
Posted On2017-03-31