Incidental Mutation 'R5972:Sympk'
ID471469
Institutional Source Beutler Lab
Gene Symbol Sympk
Ensembl Gene ENSMUSG00000023118
Gene Namesymplekin
Synonyms
MMRRC Submission 044155-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R5972 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19024377-19054618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19046824 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 751 (K751E)
Ref Sequence ENSEMBL: ENSMUSP00000023882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023882] [ENSMUST00000146903]
Predicted Effect probably benign
Transcript: ENSMUST00000023882
AA Change: K751E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023882
Gene: ENSMUSG00000023118
AA Change: K751E

DomainStartEndE-ValueType
low complexity region 106 118 N/A INTRINSIC
Pfam:DUF3453 119 352 1.1e-63 PFAM
low complexity region 473 485 N/A INTRINSIC
Pfam:Symplekin_C 887 1068 4.3e-78 PFAM
low complexity region 1123 1149 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138440
Predicted Effect probably benign
Transcript: ENSMUST00000146903
SMART Domains Protein: ENSMUSP00000138740
Gene: ENSMUSG00000023118

DomainStartEndE-ValueType
Pfam:DUF3453 117 230 1.1e-35 PFAM
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that functions in the regulation of polyadenylation and promotes gene expression. The protein forms a high-molecular weight complex with components of the polyadenylation machinery. It is thought to serve as a scaffold for recruiting regulatory factors to the polyadenylation complex. It also participates in 3'-end maturation of histone mRNAs, which do not undergo polyadenylation. The protein also localizes to the cytoplasmic plaques of tight junctions in some cell types. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous ofr a transgenic gene disruption exhibit anemia at E15 and hydrops fetalis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,672,085 M305K probably benign Het
Accs G T 2: 93,839,227 H283N probably damaging Het
Actl6b A T 5: 137,566,556 H283L possibly damaging Het
Adgra1 T C 7: 139,845,667 L32P probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arfgef2 T C 2: 166,891,836 I1672T probably damaging Het
Arntl2 A G 6: 146,809,689 M64V probably damaging Het
Bambi T A 18: 3,512,354 V246E probably damaging Het
BC048679 A G 7: 81,495,731 L29P probably damaging Het
Camk4 T C 18: 33,107,926 L92P probably damaging Het
Ddx11 C A 17: 66,148,090 Q655K probably benign Het
Ddx52 A G 11: 83,953,225 probably null Het
Eps8l3 T C 3: 107,884,447 probably null Het
Erap1 T A 13: 74,662,304 probably null Het
Fam189b T A 3: 89,185,808 V213D probably damaging Het
Flg T A 3: 93,279,542 N100K probably benign Het
Grip2 A T 6: 91,807,281 V13E probably benign Het
Iars T C 13: 49,709,632 V520A possibly damaging Het
Impa1 A G 3: 10,329,004 M1T probably null Het
Ip6k3 T C 17: 27,149,960 T179A possibly damaging Het
Krt83 T A 15: 101,487,586 M302L probably benign Het
Lrp8 T C 4: 107,869,070 Y899H probably damaging Het
Lrpprc A T 17: 84,712,822 I1145N possibly damaging Het
Mapk11 A T 15: 89,144,184 D324E probably benign Het
Melk C T 4: 44,351,007 T516I probably benign Het
Mia2 C T 12: 59,146,937 H130Y probably damaging Het
Mroh5 C T 15: 73,790,719 probably null Het
Ncam1 T C 9: 49,507,529 T824A possibly damaging Het
Neurog1 T C 13: 56,251,398 S179G probably damaging Het
Ntrk2 T A 13: 58,837,819 L79Q probably damaging Het
Patj T A 4: 98,569,053 M46K probably damaging Het
Pdcd6ip T C 9: 113,662,298 K626E probably benign Het
Pdss2 T A 10: 43,298,926 Y143N probably damaging Het
Pkhd1l1 G A 15: 44,545,416 S2433N probably damaging Het
Plekha5 A G 6: 140,572,913 T309A possibly damaging Het
Prdm4 C T 10: 85,907,501 V297M probably damaging Het
Rab15 T C 12: 76,800,603 Y148C probably damaging Het
Ryr3 A T 2: 112,834,064 N1627K probably damaging Het
Scn1a G T 2: 66,351,110 A23E possibly damaging Het
Smtn A T 11: 3,533,486 I30N probably damaging Het
Usp24 C T 4: 106,368,067 P632L probably damaging Het
Vmn2r106 A G 17: 20,278,476 I391T probably benign Het
Vmn2r54 G A 7: 12,615,352 P768S probably damaging Het
Vmn2r54 C T 7: 12,635,947 C63Y probably damaging Het
Zfhx3 T G 8: 108,950,851 C2844W possibly damaging Het
Other mutations in Sympk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Sympk APN 7 19047573 missense probably benign 0.14
IGL01834:Sympk APN 7 19043435 missense probably benign 0.02
IGL02588:Sympk APN 7 19042625 missense probably benign
IGL02601:Sympk APN 7 19048869 missense probably benign 0.31
IGL02645:Sympk APN 7 19052424 missense probably damaging 0.99
IGL02698:Sympk APN 7 19045634 missense probably benign 0.35
IGL02709:Sympk APN 7 19047538 missense probably benign 0.26
IGL02814:Sympk APN 7 19053273 missense probably damaging 1.00
IGL03198:Sympk APN 7 19044996 missense possibly damaging 0.92
butterfinger UTSW 7 19048453 missense probably damaging 0.98
fifth_avenue UTSW 7 19043460 missense possibly damaging 0.83
IGL02991:Sympk UTSW 7 19030577 missense probably damaging 1.00
R0391:Sympk UTSW 7 19046849 missense probably benign 0.06
R1036:Sympk UTSW 7 19048453 missense probably damaging 0.98
R1872:Sympk UTSW 7 19029145 missense probably benign
R2058:Sympk UTSW 7 19043529 missense probably damaging 1.00
R2103:Sympk UTSW 7 19054116 missense probably benign
R2966:Sympk UTSW 7 19030544 missense probably damaging 1.00
R3110:Sympk UTSW 7 19034484 missense possibly damaging 0.69
R3112:Sympk UTSW 7 19034484 missense possibly damaging 0.69
R3703:Sympk UTSW 7 19040561 missense probably damaging 0.99
R3775:Sympk UTSW 7 19035955 missense probably damaging 1.00
R3930:Sympk UTSW 7 19047522 missense possibly damaging 0.90
R4638:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4639:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4645:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4688:Sympk UTSW 7 19054410 missense probably benign
R5050:Sympk UTSW 7 19036042 missense probably benign 0.19
R5051:Sympk UTSW 7 19036042 missense probably benign 0.19
R5052:Sympk UTSW 7 19036042 missense probably benign 0.19
R5092:Sympk UTSW 7 19042659 missense probably benign 0.17
R5211:Sympk UTSW 7 19035889 missense probably benign 0.22
R5591:Sympk UTSW 7 19054039 missense probably damaging 1.00
R5678:Sympk UTSW 7 19049472 critical splice donor site probably null
R6387:Sympk UTSW 7 19052498 missense possibly damaging 0.94
R6543:Sympk UTSW 7 19036830 missense probably damaging 1.00
R6984:Sympk UTSW 7 19038043 missense probably benign 0.00
R7141:Sympk UTSW 7 19054092 missense probably benign
R7292:Sympk UTSW 7 19036030 missense probably benign 0.01
R7319:Sympk UTSW 7 19035845 missense probably benign
R7887:Sympk UTSW 7 19034439 missense possibly damaging 0.69
R8094:Sympk UTSW 7 19053448 critical splice donor site probably null
R8147:Sympk UTSW 7 19036793 missense probably damaging 0.98
R8409:Sympk UTSW 7 19052438 missense probably benign 0.11
RF064:Sympk UTSW 7 19034395 frame shift probably null
X0017:Sympk UTSW 7 19040663 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ACTGAGAAGTGCAGCAGCC -3'
(R):5'- GGCAGGATCTGGGACTATGC -3'

Sequencing Primer
(F):5'- CGCAGCTTGGGATACAGG -3'
(R):5'- GGGACTATGCTAAGTTTGCTCTCC -3'
Posted On2017-03-31