Mutagenetix > Incidental Mutations

Incidental Mutation 'R5972:Ncam1'

471473

Institutional Source

Beutler Lab

Gene Symbol

Ncam1

Ensembl Gene

ENSMUSG00000039542

Gene Name

neural cell adhesion molecule 1

Synonyms

NCAM-140, E-NCAM, NCAM-180, NCAM-1, CD56, NCAM-120, NCAM

MMRRC Submission

044155-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.892) question?

Stock #

R5972 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

49502136-49798925 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 49507529 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 824 (T824A)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166811] [ENSMUST00000193547]

Predicted Effect

probably benign
Transcript: ENSMUST00000166811

SMART Domains

Protein: ENSMUSP00000130668
Gene: ENSMUSG00000039542

Domain	Start	End	E-Value	Type
IGc2	32	103	2.88e-4	SMART
IGc2	130	196	6.35e-6	SMART
IGc2	226	295	6.38e-20	SMART
IGc2	321	393	4.12e-14	SMART
IGc2	418	487	9.7e-11	SMART
FN3	501	586	4.77e-8	SMART
FN3	602	683	6.97e-1	SMART
transmembrane domain	706	728	N/A	INTRINSIC
low complexity region	797	809	N/A	INTRINSIC
low complexity region	814	830	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193547

SMART Domains

Protein: ENSMUSP00000142275
Gene: ENSMUSG00000039542

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	32	103	2.88e-4	SMART
IGc2	130	196	6.35e-6	SMART
IGc2	226	295	6.38e-20	SMART
IGc2	321	393	4.12e-14	SMART
IGc2	418	487	9.7e-11	SMART
FN3	501	586	4.77e-8	SMART
FN3	602	683	6.97e-1	SMART
transmembrane domain	706	728	N/A	INTRINSIC
low complexity region	797	809	N/A	INTRINSIC
low complexity region	814	830	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000194252
AA Change: T824A

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 93.9%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell adhesion protein which is a member of the immunoglobulin superfamily. The encoded protein is involved in cell-to-cell interactions as well as cell-matrix interactions during development and differentiation. The encoded protein has been shown to be involved in development of the nervous system, and for cells involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutants show impairment in Morris water maze test, reduced brain and olfactory bulb size, hypoplasic corticospinal tract, abnormally distributed anterior pituitary cell types, and morphological and functional defects of neuromuscular junctions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg2	T	A	6: 58,672,085	M305K	probably benign	Het
Accs	G	T	2: 93,839,227	H283N	probably damaging	Het
Actl6b	A	T	5: 137,566,556	H283L	possibly damaging	Het
Adgra1	T	C	7: 139,845,667	L32P	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Arfgef2	T	C	2: 166,891,836	I1672T	probably damaging	Het
Arntl2	A	G	6: 146,809,689	M64V	probably damaging	Het
Bambi	T	A	18: 3,512,354	V246E	probably damaging	Het
BC048679	A	G	7: 81,495,731	L29P	probably damaging	Het
Camk4	T	C	18: 33,107,926	L92P	probably damaging	Het
Ddx11	C	A	17: 66,148,090	Q655K	probably benign	Het
Ddx52	A	G	11: 83,953,225		probably null	Het
Eps8l3	T	C	3: 107,884,447		probably null	Het
Erap1	T	A	13: 74,662,304		probably null	Het
Fam189b	T	A	3: 89,185,808	V213D	probably damaging	Het
Flg	T	A	3: 93,279,542	N100K	probably benign	Het
Grip2	A	T	6: 91,807,281	V13E	probably benign	Het
Iars	T	C	13: 49,709,632	V520A	possibly damaging	Het
Impa1	A	G	3: 10,329,004	M1T	probably null	Het
Ip6k3	T	C	17: 27,149,960	T179A	possibly damaging	Het
Krt83	T	A	15: 101,487,586	M302L	probably benign	Het
Lrp8	T	C	4: 107,869,070	Y899H	probably damaging	Het
Lrpprc	A	T	17: 84,712,822	I1145N	possibly damaging	Het
Mapk11	A	T	15: 89,144,184	D324E	probably benign	Het
Melk	C	T	4: 44,351,007	T516I	probably benign	Het
Mia2	C	T	12: 59,146,937	H130Y	probably damaging	Het
Mroh5	C	T	15: 73,790,719		probably null	Het
Neurog1	T	C	13: 56,251,398	S179G	probably damaging	Het
Ntrk2	T	A	13: 58,837,819	L79Q	probably damaging	Het
Patj	T	A	4: 98,569,053	M46K	probably damaging	Het
Pdcd6ip	T	C	9: 113,662,298	K626E	probably benign	Het
Pdss2	T	A	10: 43,298,926	Y143N	probably damaging	Het
Pkhd1l1	G	A	15: 44,545,416	S2433N	probably damaging	Het
Plekha5	A	G	6: 140,572,913	T309A	possibly damaging	Het
Prdm4	C	T	10: 85,907,501	V297M	probably damaging	Het
Rab15	T	C	12: 76,800,603	Y148C	probably damaging	Het
Ryr3	A	T	2: 112,834,064	N1627K	probably damaging	Het
Scn1a	G	T	2: 66,351,110	A23E	possibly damaging	Het
Smtn	A	T	11: 3,533,486	I30N	probably damaging	Het
Sympk	A	G	7: 19,046,824	K751E	probably benign	Het
Usp24	C	T	4: 106,368,067	P632L	probably damaging	Het
Vmn2r106	A	G	17: 20,278,476	I391T	probably benign	Het
Vmn2r54	G	A	7: 12,615,352	P768S	probably damaging	Het
Vmn2r54	C	T	7: 12,635,947	C63Y	probably damaging	Het
Zfhx3	T	G	8: 108,950,851	C2844W	possibly damaging	Het

Other mutations in Ncam1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00592:Ncam1	APN	9	49523565	missense	probably damaging	1.00
IGL01384:Ncam1	APN	9	49509852	missense	possibly damaging	0.76
IGL01798:Ncam1	APN	9	49508607	missense	probably damaging	1.00
IGL02239:Ncam1	APN	9	49567402	missense	probably damaging	1.00
IGL02368:Ncam1	APN	9	49543083	nonsense	probably null
IGL02616:Ncam1	APN	9	49508688	missense	probably benign	0.23
PIT4431001:Ncam1	UTSW	9	49798693	missense	probably benign	0.04
R0164:Ncam1	UTSW	9	49568409	missense	probably damaging	1.00
R0164:Ncam1	UTSW	9	49568409	missense	probably damaging	1.00
R0502:Ncam1	UTSW	9	49569818	unclassified	probably benign
R0924:Ncam1	UTSW	9	49562176	intron	probably benign
R1398:Ncam1	UTSW	9	49517589	intron	probably benign
R1440:Ncam1	UTSW	9	49544800	missense	probably damaging	1.00
R1491:Ncam1	UTSW	9	49505549	missense	probably benign	0.15
R1676:Ncam1	UTSW	9	49557172	missense	probably damaging	1.00
R1743:Ncam1	UTSW	9	49557145	missense	probably damaging	1.00
R1769:Ncam1	UTSW	9	49545256	unclassified	probably benign
R1951:Ncam1	UTSW	9	49545192	missense	probably benign	0.36
R2143:Ncam1	UTSW	9	49543019	missense	possibly damaging	0.87
R2167:Ncam1	UTSW	9	49568481	missense	probably benign	0.42
R2170:Ncam1	UTSW	9	49798681	missense	probably benign	0.06
R2290:Ncam1	UTSW	9	49523651	splice site	probably benign
R2321:Ncam1	UTSW	9	49544832	unclassified	probably benign
R3001:Ncam1	UTSW	9	49557226	missense	probably damaging	0.99
R3002:Ncam1	UTSW	9	49557226	missense	probably damaging	0.99
R4026:Ncam1	UTSW	9	49564995	missense	probably benign	0.00
R4279:Ncam1	UTSW	9	49506959	intron	probably benign
R4289:Ncam1	UTSW	9	49557172	missense	probably damaging	1.00
R4873:Ncam1	UTSW	9	49507621	intron	probably benign
R4875:Ncam1	UTSW	9	49507621	intron	probably benign
R4883:Ncam1	UTSW	9	49541883	splice site	probably null
R4899:Ncam1	UTSW	9	49545251	critical splice acceptor site	probably null
R4923:Ncam1	UTSW	9	49505479	missense	probably benign
R5041:Ncam1	UTSW	9	49566785	missense	probably damaging	1.00
R5058:Ncam1	UTSW	9	49798695	missense	probably benign	0.16
R5386:Ncam1	UTSW	9	49564874	missense	probably damaging	1.00
R5388:Ncam1	UTSW	9	49544754	missense	probably benign
R5512:Ncam1	UTSW	9	49509699	splice site	probably null
R5598:Ncam1	UTSW	9	49545751	missense	probably damaging	1.00
R5895:Ncam1	UTSW	9	49507043	missense	probably benign
R6059:Ncam1	UTSW	9	49544666	missense	probably damaging	1.00
R6226:Ncam1	UTSW	9	49565004	missense	probably benign	0.00
R6392:Ncam1	UTSW	9	49523575	missense	probably damaging	0.99
R6750:Ncam1	UTSW	9	49567339	missense	probably damaging	1.00
R6799:Ncam1	UTSW	9	49508611	missense	probably damaging	0.99
R7230:Ncam1	UTSW	9	49509823	missense	probably benign	0.00
R7335:Ncam1	UTSW	9	49506911	missense
R7561:Ncam1	UTSW	9	49564942	missense	probably damaging	1.00
R7645:Ncam1	UTSW	9	49565003	missense	probably benign	0.01
X0062:Ncam1	UTSW	9	49545601	nonsense	probably null
X0064:Ncam1	UTSW	9	49566680	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGCTGAAGTTGGAGTATCAC -3'
(R):5'- GTGTATGGTTGCATGCCCAC -3'

Sequencing Primer
(F):5'- GAGTATCACTCAGGTCAACCAG -3'
(R):5'- AGCTTCTCTGTCATGTCTCAG -3'

Posted On

2017-03-31