Incidental Mutation 'R5972:Ip6k3'
ID471494
Institutional Source Beutler Lab
Gene Symbol Ip6k3
Ensembl Gene ENSMUSG00000024210
Gene Nameinositol hexaphosphate kinase 3
SynonymsD830007E07Rik, Ihpk3
MMRRC Submission 044155-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5972 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location27143969-27167764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27149960 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 179 (T179A)
Ref Sequence ENSEMBL: ENSMUSP00000025046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025046]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025046
AA Change: T179A

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025046
Gene: ENSMUSG00000024210
AA Change: T179A

DomainStartEndE-ValueType
Pfam:IPK 193 390 3e-68 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the inositol phosphokinase (IPK) family. This protein is likely responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered cerebellar Purkinje cell morphology, reduced synapse number, and defects in motor learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,672,085 M305K probably benign Het
Accs G T 2: 93,839,227 H283N probably damaging Het
Actl6b A T 5: 137,566,556 H283L possibly damaging Het
Adgra1 T C 7: 139,845,667 L32P probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arfgef2 T C 2: 166,891,836 I1672T probably damaging Het
Arntl2 A G 6: 146,809,689 M64V probably damaging Het
Bambi T A 18: 3,512,354 V246E probably damaging Het
BC048679 A G 7: 81,495,731 L29P probably damaging Het
Camk4 T C 18: 33,107,926 L92P probably damaging Het
Ddx11 C A 17: 66,148,090 Q655K probably benign Het
Ddx52 A G 11: 83,953,225 probably null Het
Eps8l3 T C 3: 107,884,447 probably null Het
Erap1 T A 13: 74,662,304 probably null Het
Fam189b T A 3: 89,185,808 V213D probably damaging Het
Flg T A 3: 93,279,542 N100K probably benign Het
Grip2 A T 6: 91,807,281 V13E probably benign Het
Iars T C 13: 49,709,632 V520A possibly damaging Het
Impa1 A G 3: 10,329,004 M1T probably null Het
Krt83 T A 15: 101,487,586 M302L probably benign Het
Lrp8 T C 4: 107,869,070 Y899H probably damaging Het
Lrpprc A T 17: 84,712,822 I1145N possibly damaging Het
Mapk11 A T 15: 89,144,184 D324E probably benign Het
Melk C T 4: 44,351,007 T516I probably benign Het
Mia2 C T 12: 59,146,937 H130Y probably damaging Het
Mroh5 C T 15: 73,790,719 probably null Het
Ncam1 T C 9: 49,507,529 T824A possibly damaging Het
Neurog1 T C 13: 56,251,398 S179G probably damaging Het
Ntrk2 T A 13: 58,837,819 L79Q probably damaging Het
Patj T A 4: 98,569,053 M46K probably damaging Het
Pdcd6ip T C 9: 113,662,298 K626E probably benign Het
Pdss2 T A 10: 43,298,926 Y143N probably damaging Het
Pkhd1l1 G A 15: 44,545,416 S2433N probably damaging Het
Plekha5 A G 6: 140,572,913 T309A possibly damaging Het
Prdm4 C T 10: 85,907,501 V297M probably damaging Het
Rab15 T C 12: 76,800,603 Y148C probably damaging Het
Ryr3 A T 2: 112,834,064 N1627K probably damaging Het
Scn1a G T 2: 66,351,110 A23E possibly damaging Het
Smtn A T 11: 3,533,486 I30N probably damaging Het
Sympk A G 7: 19,046,824 K751E probably benign Het
Usp24 C T 4: 106,368,067 P632L probably damaging Het
Vmn2r106 A G 17: 20,278,476 I391T probably benign Het
Vmn2r54 G A 7: 12,615,352 P768S probably damaging Het
Vmn2r54 C T 7: 12,635,947 C63Y probably damaging Het
Zfhx3 T G 8: 108,950,851 C2844W possibly damaging Het
Other mutations in Ip6k3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Ip6k3 APN 17 27151060 missense probably benign
R0200:Ip6k3 UTSW 17 27145025 missense probably damaging 1.00
R0220:Ip6k3 UTSW 17 27145229 missense probably damaging 1.00
R1448:Ip6k3 UTSW 17 27145268 missense possibly damaging 0.90
R1749:Ip6k3 UTSW 17 27145079 missense probably benign 0.00
R1956:Ip6k3 UTSW 17 27151168 missense probably benign 0.01
R1957:Ip6k3 UTSW 17 27151168 missense probably benign 0.01
R3125:Ip6k3 UTSW 17 27157542 missense probably damaging 1.00
R3798:Ip6k3 UTSW 17 27145106 missense probably benign 0.01
R3806:Ip6k3 UTSW 17 27145000 missense probably damaging 1.00
R4445:Ip6k3 UTSW 17 27145102 missense probably benign 0.10
R4506:Ip6k3 UTSW 17 27145180 missense possibly damaging 0.69
R4651:Ip6k3 UTSW 17 27145291 missense probably damaging 1.00
R6119:Ip6k3 UTSW 17 27148625 missense possibly damaging 0.72
R7140:Ip6k3 UTSW 17 27144995 missense probably damaging 1.00
R7340:Ip6k3 UTSW 17 27148530 missense probably benign 0.00
R7811:Ip6k3 UTSW 17 27157583 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTTGTATGTGACTGCTCC -3'
(R):5'- GGCTTTTGTCAGAGGCCATG -3'

Sequencing Primer
(F):5'- TGACTGCTCCTGTGAGTGCC -3'
(R):5'- TTCCTCTGGCAGCTGCTGAG -3'
Posted On2017-03-31