Incidental Mutation 'R5973:Actr1b'
ID471503
Institutional Source Beutler Lab
Gene Symbol Actr1b
Ensembl Gene ENSMUSG00000037351
Gene NameARP1 actin-related protein 1B, centractin beta
Synonyms2310066K23Rik, Arp1b
MMRRC Submission 044156-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R5973 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location36698114-36714422 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36702081 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 140 (S140P)
Ref Sequence ENSEMBL: ENSMUSP00000047326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043951] [ENSMUST00000159448] [ENSMUST00000160084]
Predicted Effect probably damaging
Transcript: ENSMUST00000043951
AA Change: S140P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047326
Gene: ENSMUSG00000037351
AA Change: S140P

DomainStartEndE-ValueType
ACTIN 9 376 9.61e-203 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159448
AA Change: S96P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124343
Gene: ENSMUSG00000037351
AA Change: S96P

DomainStartEndE-ValueType
ACTIN 2 149 1.29e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160043
Predicted Effect probably damaging
Transcript: ENSMUST00000160084
AA Change: S96P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125472
Gene: ENSMUSG00000037351
AA Change: S96P

DomainStartEndE-ValueType
Pfam:Actin 2 142 2.3e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162684
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 42.3 kD subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein and is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit, like ACTR1A, is an actin-related protein. These two proteins, which are of equal length and share 90% amino acid identity, are present in a constant ratio of approximately 1:15 in the dynactin complex. [provided by RefSeq, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,226,867 I1536N probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc7 A T 5: 122,428,303 T92S probably benign Het
Ash2l G A 8: 25,817,614 T585M possibly damaging Het
Asxl1 T C 2: 153,402,011 F1495L probably damaging Het
Atp5j T C 16: 84,828,440 probably null Het
Bcl2a1c A G 9: 114,330,397 N81S probably benign Het
Bfsp2 A C 9: 103,432,657 probably null Het
Casq1 A G 1: 172,219,501 Y64H probably damaging Het
Ceacam16 A G 7: 19,856,337 V227A probably damaging Het
Cers6 T A 2: 69,068,625 probably null Het
Chrnb1 A G 11: 69,795,845 probably benign Het
Clpb G A 7: 101,663,997 V63I probably benign Het
Dnah11 G T 12: 118,110,952 D1388E probably benign Het
Dst T C 1: 34,156,857 L405P probably damaging Het
Dstyk A G 1: 132,434,411 E193G probably damaging Het
Dusp2 A T 2: 127,337,288 S188C probably damaging Het
Ep400 T C 5: 110,729,831 I810V unknown Het
Faim2 C T 15: 99,521,251 G79D probably benign Het
Fpgt A T 3: 155,087,403 I329K probably damaging Het
Fut8 A G 12: 77,364,997 T78A probably benign Het
Gm10436 T C 12: 88,175,913 I312V probably benign Het
Gm14124 A G 2: 150,267,935 T182A unknown Het
Gm15130 A G 2: 111,135,369 probably benign Het
Gm17087 A C 17: 8,566,697 I58R probably benign Het
Gm5724 T A 6: 141,754,456 T117S probably benign Het
Grk2 T C 19: 4,287,897 D485G possibly damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hmcn1 A G 1: 150,563,817 S5539P probably damaging Het
Hmcn2 G A 2: 31,420,323 V3310M probably damaging Het
Impdh1 A T 6: 29,207,162 L61Q probably damaging Het
Inhbb A T 1: 119,418,076 V161D possibly damaging Het
Kansl2 C T 15: 98,529,425 V192M probably damaging Het
Krt2 T C 15: 101,816,312 K288E probably damaging Het
Lyar A G 5: 38,227,946 K110R probably damaging Het
Lyrm9 C A 11: 78,836,135 H35N probably damaging Het
Mab21l1 A G 3: 55,783,112 D40G probably benign Het
Maml2 A C 9: 13,621,619 probably benign Het
Mbd5 A G 2: 49,272,389 H69R probably benign Het
Morc2b G T 17: 33,137,472 A442E probably damaging Het
Moxd2 A T 6: 40,878,810 L615Q probably damaging Het
Msh2 G A 17: 87,708,583 G548S probably damaging Het
Napg G A 18: 62,994,983 S279N possibly damaging Het
Ncor1 A T 11: 62,349,310 probably null Het
Nkiras2 G T 11: 100,626,040 R128L probably damaging Het
Npy4r T C 14: 34,146,707 D208G probably benign Het
Olfr1333 C T 4: 118,830,216 V75I probably benign Het
Olfr589 A G 7: 103,154,874 V291A possibly damaging Het
Olfr901 G T 9: 38,430,331 L16F probably damaging Het
Pcdhgb2 A G 18: 37,690,507 T184A probably benign Het
Plxna4 T C 6: 32,251,065 probably null Het
Pnldc1 C T 17: 12,894,373 E328K probably benign Het
Pon1 T A 6: 5,185,334 L55F probably damaging Het
Prkci G T 3: 31,038,456 D296Y probably damaging Het
Prkd1 T C 12: 50,388,255 H563R probably damaging Het
Ptpru T C 4: 131,818,925 N266S probably benign Het
Rapgef6 A T 11: 54,639,783 I589F probably damaging Het
Rcan3 A T 4: 135,418,542 S127T probably benign Het
Sh3tc2 A G 18: 61,977,904 D277G probably benign Het
Sipa1l3 G A 7: 29,399,524 A440V probably benign Het
Slc13a2 A C 11: 78,400,532 I372S probably damaging Het
Spns1 A T 7: 126,370,323 I528N probably damaging Het
Sult6b2 T C 6: 142,790,295 K191R probably benign Het
Swt1 A G 1: 151,402,949 probably null Het
Tcn2 A T 11: 3,927,546 L34* probably null Het
Tmem131l C T 3: 83,922,246 A1035T possibly damaging Het
Trpc4 A G 3: 54,315,842 E733G probably damaging Het
Uap1l1 A T 2: 25,364,630 H184Q possibly damaging Het
Vil1 T G 1: 74,416,033 V48G possibly damaging Het
Vps39 A T 2: 120,328,705 H367Q probably damaging Het
Wars2 A G 3: 99,187,646 T86A probably benign Het
Wdr90 A G 17: 25,845,133 S1872P probably damaging Het
Wdr90 A G 17: 25,846,407 L1625P probably damaging Het
Xaf1 A T 11: 72,303,430 M46L probably damaging Het
Other mutations in Actr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02453:Actr1b APN 1 36702507 missense probably damaging 0.99
IGL02555:Actr1b APN 1 36701747 missense probably damaging 1.00
R1267:Actr1b UTSW 1 36700104 missense probably benign 0.11
R2064:Actr1b UTSW 1 36702087 missense possibly damaging 0.83
R2231:Actr1b UTSW 1 36700359 missense probably damaging 1.00
R4243:Actr1b UTSW 1 36701830 missense possibly damaging 0.61
R4244:Actr1b UTSW 1 36701830 missense possibly damaging 0.61
R4245:Actr1b UTSW 1 36701830 missense possibly damaging 0.61
R5256:Actr1b UTSW 1 36700092 missense probably benign 0.31
R6267:Actr1b UTSW 1 36701163 missense possibly damaging 0.63
R7213:Actr1b UTSW 1 36702140 missense probably damaging 1.00
R7473:Actr1b UTSW 1 36709819 missense probably benign 0.01
Z1176:Actr1b UTSW 1 36701208 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTCAGTATGCTTTTACATCAGC -3'
(R):5'- TAAATGCTCCACGGCTTGGG -3'

Sequencing Primer
(F):5'- GTATGCTTTTACATCAGCCACTGAGG -3'
(R):5'- CTGATTCAGATGGAGTCCTCAAG -3'
Posted On2017-03-31