Mutagenetix > Incidental Mutation

Incidental Mutation 'R5973:Acacb'

471534

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

044156-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5973 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 114226867 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1536 (I1536N)

Ref Sequence

ENSEMBL: ENSMUSP00000099642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

AlphaFold

E9Q4Z2

Predicted Effect

probably damaging
Transcript: ENSMUST00000031583
AA Change: I1536N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: I1536N

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102582
AA Change: I1536N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: I1536N

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143276

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr1b	A	G	1: 36,702,081	S140P	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc7	A	T	5: 122,428,303	T92S	probably benign	Het
Ash2l	G	A	8: 25,817,614	T585M	possibly damaging	Het
Asxl1	T	C	2: 153,402,011	F1495L	probably damaging	Het
Atp5j	T	C	16: 84,828,440		probably null	Het
Bcl2a1c	A	G	9: 114,330,397	N81S	probably benign	Het
Bfsp2	A	C	9: 103,432,657		probably null	Het
Casq1	A	G	1: 172,219,501	Y64H	probably damaging	Het
Ceacam16	A	G	7: 19,856,337	V227A	probably damaging	Het
Cers6	T	A	2: 69,068,625		probably null	Het
Chrnb1	A	G	11: 69,795,845		probably benign	Het
Clpb	G	A	7: 101,663,997	V63I	probably benign	Het
Dnah11	G	T	12: 118,110,952	D1388E	probably benign	Het
Dst	T	C	1: 34,156,857	L405P	probably damaging	Het
Dstyk	A	G	1: 132,434,411	E193G	probably damaging	Het
Dusp2	A	T	2: 127,337,288	S188C	probably damaging	Het
Ep400	T	C	5: 110,729,831	I810V	unknown	Het
Faim2	C	T	15: 99,521,251	G79D	probably benign	Het
Fpgt	A	T	3: 155,087,403	I329K	probably damaging	Het
Fut8	A	G	12: 77,364,997	T78A	probably benign	Het
Gm10436	T	C	12: 88,175,913	I312V	probably benign	Het
Gm14124	A	G	2: 150,267,935	T182A	unknown	Het
Gm15130	A	G	2: 111,135,369		probably benign	Het
Gm17087	A	C	17: 8,566,697	I58R	probably benign	Het
Gm5724	T	A	6: 141,754,456	T117S	probably benign	Het
Grk2	T	C	19: 4,287,897	D485G	possibly damaging	Het
Hax1	GTCATCATCATCATCATC	GTCATCATCATCATCATCATC	3: 89,997,940		probably benign	Het
Hmcn1	A	G	1: 150,563,817	S5539P	probably damaging	Het
Hmcn2	G	A	2: 31,420,323	V3310M	probably damaging	Het
Impdh1	A	T	6: 29,207,162	L61Q	probably damaging	Het
Inhbb	A	T	1: 119,418,076	V161D	possibly damaging	Het
Kansl2	C	T	15: 98,529,425	V192M	probably damaging	Het
Krt2	T	C	15: 101,816,312	K288E	probably damaging	Het
Lyar	A	G	5: 38,227,946	K110R	probably damaging	Het
Lyrm9	C	A	11: 78,836,135	H35N	probably damaging	Het
Mab21l1	A	G	3: 55,783,112	D40G	probably benign	Het
Maml2	A	C	9: 13,621,619		probably benign	Het
Mbd5	A	G	2: 49,272,389	H69R	probably benign	Het
Morc2b	G	T	17: 33,137,472	A442E	probably damaging	Het
Moxd2	A	T	6: 40,878,810	L615Q	probably damaging	Het
Msh2	G	A	17: 87,708,583	G548S	probably damaging	Het
Napg	G	A	18: 62,994,983	S279N	possibly damaging	Het
Ncor1	A	T	11: 62,349,310		probably null	Het
Nkiras2	G	T	11: 100,626,040	R128L	probably damaging	Het
Npy4r	T	C	14: 34,146,707	D208G	probably benign	Het
Olfr1333	C	T	4: 118,830,216	V75I	probably benign	Het
Olfr589	A	G	7: 103,154,874	V291A	possibly damaging	Het
Olfr901	G	T	9: 38,430,331	L16F	probably damaging	Het
Pcdhgb2	A	G	18: 37,690,507	T184A	probably benign	Het
Plxna4	T	C	6: 32,251,065		probably null	Het
Pnldc1	C	T	17: 12,894,373	E328K	probably benign	Het
Pon1	T	A	6: 5,185,334	L55F	probably damaging	Het
Prkci	G	T	3: 31,038,456	D296Y	probably damaging	Het
Prkd1	T	C	12: 50,388,255	H563R	probably damaging	Het
Ptpru	T	C	4: 131,818,925	N266S	probably benign	Het
Rapgef6	A	T	11: 54,639,783	I589F	probably damaging	Het
Rcan3	A	T	4: 135,418,542	S127T	probably benign	Het
Sh3tc2	A	G	18: 61,977,904	D277G	probably benign	Het
Sipa1l3	G	A	7: 29,399,524	A440V	probably benign	Het
Slc13a2	A	C	11: 78,400,532	I372S	probably damaging	Het
Spns1	A	T	7: 126,370,323	I528N	probably damaging	Het
Sult6b2	T	C	6: 142,790,295	K191R	probably benign	Het
Swt1	A	G	1: 151,402,949		probably null	Het
Tcn2	A	T	11: 3,927,546	L34*	probably null	Het
Tmem131l	C	T	3: 83,922,246	A1035T	possibly damaging	Het
Trpc4	A	G	3: 54,315,842	E733G	probably damaging	Het
Uap1l1	A	T	2: 25,364,630	H184Q	possibly damaging	Het
Vil1	T	G	1: 74,416,033	V48G	possibly damaging	Het
Vps39	A	T	2: 120,328,705	H367Q	probably damaging	Het
Wars2	A	G	3: 99,187,646	T86A	probably benign	Het
Wdr90	A	G	17: 25,845,133	S1872P	probably damaging	Het
Wdr90	A	G	17: 25,846,407	L1625P	probably damaging	Het
Xaf1	A	T	11: 72,303,430	M46L	probably damaging	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9008:Acacb	UTSW	5	114248754	splice site	silent
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CAGTGACAAATGGACTGTCCTC -3'
(R):5'- GTACCGCTAGCTGATGTGTCTG -3'

Sequencing Primer
(F):5'- GAAGACCGGATTTATCGCCACTTG -3'
(R):5'- TCTGCAAGGAGTCAGGATACCTC -3'

Posted On

2017-03-31