Incidental Mutation 'R0501:Nid2'
ID47154
Institutional Source Beutler Lab
Gene Symbol Nid2
Ensembl Gene ENSMUSG00000021806
Gene Namenidogen 2
Synonymsentactin 2, entactin-2
MMRRC Submission 038696-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R0501 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location19751265-19811787 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 19789668 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000022340] [ENSMUST00000022340]
Predicted Effect probably null
Transcript: ENSMUST00000022340
SMART Domains Protein: ENSMUSP00000022340
Gene: ENSMUSG00000021806

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Blast:NIDO 39 77 3e-11 BLAST
NIDO 108 276 1.12e-72 SMART
low complexity region 421 430 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
EGF 510 547 1.84e1 SMART
G2F 548 780 4.36e-143 SMART
EGF 785 823 2.52e-2 SMART
EGF_CA 824 866 1.45e-11 SMART
EGF 874 914 3.15e-3 SMART
EGF_CA 915 953 5.03e-11 SMART
TY 988 1037 8.27e-20 SMART
TY 1068 1116 1.19e-20 SMART
LY 1162 1204 1.15e-5 SMART
LY 1206 1248 8.82e-16 SMART
LY 1249 1293 1.51e-14 SMART
LY 1294 1336 3.56e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000022340
SMART Domains Protein: ENSMUSP00000022340
Gene: ENSMUSG00000021806

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Blast:NIDO 39 77 3e-11 BLAST
NIDO 108 276 1.12e-72 SMART
low complexity region 421 430 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
EGF 510 547 1.84e1 SMART
G2F 548 780 4.36e-143 SMART
EGF 785 823 2.52e-2 SMART
EGF_CA 824 866 1.45e-11 SMART
EGF 874 914 3.15e-3 SMART
EGF_CA 915 953 5.03e-11 SMART
TY 988 1037 8.27e-20 SMART
TY 1068 1116 1.19e-20 SMART
LY 1162 1204 1.15e-5 SMART
LY 1206 1248 8.82e-16 SMART
LY 1249 1293 1.51e-14 SMART
LY 1294 1336 3.56e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000224263
Predicted Effect probably null
Transcript: ENSMUST00000224263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225791
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nidogen family of basement membrane proteins. This protein is a cell-adhesion protein that binds collagens I and IV and laminin and may be involved in maintaining the structure of the basement membrane.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a null alleleexhibit calcification of joint cartilage and osteoarthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,372 S415P probably benign Het
Adam19 C T 11: 46,123,130 P316S probably damaging Het
Adamts2 A G 11: 50,668,145 D229G probably benign Het
Adcy10 C T 1: 165,510,390 P191L probably damaging Het
Adgrv1 T C 13: 81,559,150 Y1379C probably damaging Het
Akap9 T C 5: 3,970,685 L1132P probably damaging Het
Aoah A G 13: 21,005,073 T489A probably benign Het
Apc2 T C 10: 80,315,124 L1975P probably damaging Het
Bpifa5 A T 2: 154,163,696 D66V probably benign Het
C230029F24Rik T C 1: 49,335,470 noncoding transcript Het
Cacna1h A T 17: 25,388,667 V892E probably damaging Het
Car4 G A 11: 84,963,442 V72I probably benign Het
Chst3 A G 10: 60,186,227 L266P probably damaging Het
Ckap2l G A 2: 129,285,491 R256W possibly damaging Het
Cntn4 A T 6: 106,618,335 D471V probably damaging Het
Cntrob G A 11: 69,322,868 S32F probably damaging Het
Cpne7 T A 8: 123,126,255 N200K possibly damaging Het
Creb3l3 C A 10: 81,086,582 M271I probably benign Het
Csmd1 T A 8: 17,027,323 Q106L probably damaging Het
D7Ertd443e G A 7: 134,294,972 T563I probably damaging Het
Dmac1 T G 4: 75,278,176 N26H unknown Het
Dopey2 T C 16: 93,752,862 F230L probably benign Het
Dpp6 T A 5: 27,725,606 I812N probably damaging Het
Fabp12 T C 3: 10,250,143 D48G probably benign Het
Fbn1 G A 2: 125,301,749 T2820M probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fcho2 A T 13: 98,764,515 S277R possibly damaging Het
Fmo2 A G 1: 162,876,928 S470P probably benign Het
Gm17541 T G 12: 4,689,730 probably benign Het
Gm4353 A T 7: 116,083,471 Y292N probably benign Het
Igkv4-71 A T 6: 69,243,306 I69N probably damaging Het
Insrr G T 3: 87,810,684 A871S probably benign Het
Irs2 C T 8: 11,006,396 V679M probably damaging Het
Itpr3 T A 17: 27,107,289 H1344Q probably benign Het
Kcnma1 T C 14: 23,311,716 M1074V possibly damaging Het
Kif1a G A 1: 93,056,245 R602W probably damaging Het
Kif21b A T 1: 136,163,099 D1215V probably benign Het
Maats1 C G 16: 38,335,635 M75I probably damaging Het
Mapk13 G A 17: 28,776,353 V183M probably damaging Het
Mbp C T 18: 82,575,197 S100F probably damaging Het
Mcm6 A G 1: 128,355,636 I44T probably benign Het
Ncor1 T A 11: 62,373,322 D418V possibly damaging Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Olfr1024 A G 2: 85,905,004 F17L probably damaging Het
Olfr1121 A T 2: 87,371,552 R7W probably damaging Het
Olfr1162 A T 2: 88,050,471 I51N probably damaging Het
Olfr1240 T C 2: 89,439,716 T188A probably benign Het
Olfr1338 C A 4: 118,753,830 C238F probably benign Het
Olfr1508 T A 14: 52,463,926 M1L possibly damaging Het
Olfr3 A T 2: 36,812,480 L204* probably null Het
Olfr70 A C 4: 43,697,079 C31W probably damaging Het
Olfr700 G A 7: 106,805,811 S217F probably damaging Het
Olfr705 A T 7: 106,714,603 M26K probably benign Het
Olfr713 A T 7: 107,036,232 T26S probably benign Het
Olfr855 T A 9: 19,584,618 I27N probably damaging Het
Pcgf3 T A 5: 108,475,112 C38S probably damaging Het
Pdia4 A T 6: 47,801,002 V352E probably damaging Het
Pik3c2a C A 7: 116,354,055 V1202L probably damaging Het
Rbm15 G T 3: 107,332,530 A184E possibly damaging Het
Rsph3a T A 17: 7,979,120 L442* probably null Het
Scg2 G C 1: 79,435,603 L468V probably damaging Het
Sdk1 A T 5: 141,937,718 I365L probably benign Het
Setdb1 A G 3: 95,338,829 V595A probably benign Het
Slc22a22 T A 15: 57,249,650 T398S probably benign Het
Stk11 C A 10: 80,126,285 P217Q probably damaging Het
Tes G A 6: 17,097,558 D222N probably benign Het
Tmem132e T A 11: 82,435,068 I206N possibly damaging Het
Tmem214 G T 5: 30,872,532 R251L probably damaging Het
Tmem253 T A 14: 52,018,579 I105N probably damaging Het
Toe1 A G 4: 116,807,485 V12A probably benign Het
Top1 C A 2: 160,714,159 H513N probably damaging Het
Tph1 G T 7: 46,649,988 Y376* probably null Het
Trim45 T A 3: 100,923,219 L103Q probably damaging Het
Ttc37 A C 13: 76,147,806 M1063L probably benign Het
Ttn T A 2: 76,944,174 probably null Het
Twnk T C 19: 45,007,746 V206A probably damaging Het
Ube2z A G 11: 96,050,288 S343P probably damaging Het
Vmn2r8 T C 5: 108,803,183 D132G probably benign Het
Wdr20rt A T 12: 65,225,807 T15S probably benign Het
Wdr59 C T 8: 111,458,947 R841Q possibly damaging Het
Wdtc1 A G 4: 133,308,840 F130L possibly damaging Het
Wnk1 C T 6: 119,962,803 R43Q probably damaging Het
Ythdf3 T C 3: 16,205,072 L461P probably damaging Het
Zcchc2 T G 1: 106,016,091 F462C possibly damaging Het
Other mutations in Nid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Nid2 APN 14 19768677 missense probably benign
IGL01788:Nid2 APN 14 19807979 missense probably damaging 1.00
IGL02259:Nid2 APN 14 19768209 critical splice acceptor site probably null
IGL03084:Nid2 APN 14 19768932 missense probably benign 0.05
IGL03247:Nid2 APN 14 19779620 missense probably damaging 1.00
IGL03098:Nid2 UTSW 14 19805938 missense probably damaging 0.99
PIT4810001:Nid2 UTSW 14 19810090 missense possibly damaging 0.82
R0173:Nid2 UTSW 14 19802332 splice site probably benign
R1117:Nid2 UTSW 14 19763664 critical splice acceptor site probably null
R1305:Nid2 UTSW 14 19768862 missense probably benign 0.00
R1572:Nid2 UTSW 14 19805412 missense probably benign 0.08
R1594:Nid2 UTSW 14 19781261 missense probably benign 0.03
R1789:Nid2 UTSW 14 19752431 missense possibly damaging 0.95
R1927:Nid2 UTSW 14 19768276 missense probably damaging 1.00
R2085:Nid2 UTSW 14 19778043 missense probably benign 0.12
R2086:Nid2 UTSW 14 19778043 missense probably benign 0.12
R2100:Nid2 UTSW 14 19778878 nonsense probably null
R2158:Nid2 UTSW 14 19778043 missense probably benign 0.12
R2240:Nid2 UTSW 14 19805914 missense probably damaging 0.99
R2314:Nid2 UTSW 14 19789761 missense probably benign 0.01
R2863:Nid2 UTSW 14 19768403 missense possibly damaging 0.92
R3113:Nid2 UTSW 14 19778043 missense probably benign 0.12
R3545:Nid2 UTSW 14 19763711 missense probably damaging 1.00
R3548:Nid2 UTSW 14 19763711 missense probably damaging 1.00
R3801:Nid2 UTSW 14 19809997 missense probably damaging 1.00
R4618:Nid2 UTSW 14 19808010 missense probably damaging 0.99
R4798:Nid2 UTSW 14 19789761 missense probably benign 0.01
R4953:Nid2 UTSW 14 19778078 nonsense probably null
R5256:Nid2 UTSW 14 19768208 critical splice acceptor site probably null
R5289:Nid2 UTSW 14 19805311 missense possibly damaging 0.95
R5302:Nid2 UTSW 14 19779701 missense probably benign
R5409:Nid2 UTSW 14 19805962 missense probably damaging 1.00
R5514:Nid2 UTSW 14 19802467 missense probably damaging 1.00
R6134:Nid2 UTSW 14 19778783 missense probably damaging 1.00
R6365:Nid2 UTSW 14 19803133 missense probably damaging 1.00
R6647:Nid2 UTSW 14 19802416 missense probably benign 0.04
R6758:Nid2 UTSW 14 19802483 missense probably damaging 1.00
R6882:Nid2 UTSW 14 19789707 missense probably damaging 1.00
R6893:Nid2 UTSW 14 19789787 missense probably benign 0.34
R7045:Nid2 UTSW 14 19779681 missense possibly damaging 0.94
R7392:Nid2 UTSW 14 19768656 missense probably benign 0.00
R7477:Nid2 UTSW 14 19805973 missense probably benign 0.09
R7515:Nid2 UTSW 14 19791567 missense probably benign 0.06
R7547:Nid2 UTSW 14 19797277 missense probably benign
R7594:Nid2 UTSW 14 19768723 missense probably benign 0.00
R7615:Nid2 UTSW 14 19802530 missense probably damaging 1.00
R7680:Nid2 UTSW 14 19779647 missense probably damaging 1.00
RF002:Nid2 UTSW 14 19751366 small deletion probably benign
RF016:Nid2 UTSW 14 19751363 small deletion probably benign
X0009:Nid2 UTSW 14 19802511 missense probably damaging 1.00
X0021:Nid2 UTSW 14 19768862 missense probably benign 0.00
X0026:Nid2 UTSW 14 19778131 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAGCGACTGACAAACTCAGCC -3'
(R):5'- TGGAGAACATGTCTCTCACCCACAC -3'

Sequencing Primer
(F):5'- TTCTTGCCCTGGAAGCAAAC -3'
(R):5'- ACACAGCTCCGTCCGTC -3'
Posted On2013-06-12