Incidental Mutation 'R5973:Tcn2'
ID471554
Institutional Source Beutler Lab
Gene Symbol Tcn2
Ensembl Gene ENSMUSG00000020432
Gene Nametranscobalamin 2
SynonymsTcn-2
MMRRC Submission 044156-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5973 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location3917192-3932159 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 3927546 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 34 (L34*)
Ref Sequence ENSEMBL: ENSMUSP00000105620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020710] [ENSMUST00000109988] [ENSMUST00000109989] [ENSMUST00000109990] [ENSMUST00000109991] [ENSMUST00000109992] [ENSMUST00000109993]
Predicted Effect probably null
Transcript: ENSMUST00000020710
AA Change: L34*
SMART Domains Protein: ENSMUSP00000020710
Gene: ENSMUSG00000020432
AA Change: L34*

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109988
AA Change: L34*
SMART Domains Protein: ENSMUSP00000105615
Gene: ENSMUSG00000020432
AA Change: L34*

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109989
AA Change: L34*
SMART Domains Protein: ENSMUSP00000105616
Gene: ENSMUSG00000020432
AA Change: L34*

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109990
AA Change: L34*
SMART Domains Protein: ENSMUSP00000105617
Gene: ENSMUSG00000020432
AA Change: L34*

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109991
AA Change: L34*
SMART Domains Protein: ENSMUSP00000105618
Gene: ENSMUSG00000020432
AA Change: L34*

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 3 331 1.2e-118 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 429 9.3e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109992
AA Change: L34*
SMART Domains Protein: ENSMUSP00000105619
Gene: ENSMUSG00000020432
AA Change: L34*

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109993
AA Change: L34*
SMART Domains Protein: ENSMUSP00000105620
Gene: ENSMUSG00000020432
AA Change: L34*

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vitamin B12-binding protein family. This family of proteins, alternatively referred to as R binders, is expressed in various tissues and secretions. This plasma protein binds cobalamin and mediates the transport of cobalamin into cells. This protein and other mammalian cobalamin-binding proteins, such as transcobalamin I and gastric intrisic factor, may have evolved by duplication of a common ancestral gene. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: This locus controls transcobalamin-2 electrophoretic variation. The s allele determines a slow band in serum from A/J, C57BL/6, BALB/c and C3H/He; the f allele determines faster form in NZB, ST/b and CPB-WV. Heterozygotes have both forms. Sequencing reveals a Gly to Glu substitution in NZB compared to BALB/c, DBA/2 and C57BL/6 (Genbank AF090686). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,226,867 I1536N probably damaging Het
Actr1b A G 1: 36,702,081 S140P probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc7 A T 5: 122,428,303 T92S probably benign Het
Ash2l G A 8: 25,817,614 T585M possibly damaging Het
Asxl1 T C 2: 153,402,011 F1495L probably damaging Het
Atp5j T C 16: 84,828,440 probably null Het
Bcl2a1c A G 9: 114,330,397 N81S probably benign Het
Bfsp2 A C 9: 103,432,657 probably null Het
Casq1 A G 1: 172,219,501 Y64H probably damaging Het
Ceacam16 A G 7: 19,856,337 V227A probably damaging Het
Cers6 T A 2: 69,068,625 probably null Het
Chrnb1 A G 11: 69,795,845 probably benign Het
Clpb G A 7: 101,663,997 V63I probably benign Het
Dnah11 G T 12: 118,110,952 D1388E probably benign Het
Dst T C 1: 34,156,857 L405P probably damaging Het
Dstyk A G 1: 132,434,411 E193G probably damaging Het
Dusp2 A T 2: 127,337,288 S188C probably damaging Het
Ep400 T C 5: 110,729,831 I810V unknown Het
Faim2 C T 15: 99,521,251 G79D probably benign Het
Fpgt A T 3: 155,087,403 I329K probably damaging Het
Fut8 A G 12: 77,364,997 T78A probably benign Het
Gm10436 T C 12: 88,175,913 I312V probably benign Het
Gm14124 A G 2: 150,267,935 T182A unknown Het
Gm15130 A G 2: 111,135,369 probably benign Het
Gm17087 A C 17: 8,566,697 I58R probably benign Het
Gm5724 T A 6: 141,754,456 T117S probably benign Het
Grk2 T C 19: 4,287,897 D485G possibly damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hmcn1 A G 1: 150,563,817 S5539P probably damaging Het
Hmcn2 G A 2: 31,420,323 V3310M probably damaging Het
Impdh1 A T 6: 29,207,162 L61Q probably damaging Het
Inhbb A T 1: 119,418,076 V161D possibly damaging Het
Kansl2 C T 15: 98,529,425 V192M probably damaging Het
Krt2 T C 15: 101,816,312 K288E probably damaging Het
Lyar A G 5: 38,227,946 K110R probably damaging Het
Lyrm9 C A 11: 78,836,135 H35N probably damaging Het
Mab21l1 A G 3: 55,783,112 D40G probably benign Het
Maml2 A C 9: 13,621,619 probably benign Het
Mbd5 A G 2: 49,272,389 H69R probably benign Het
Morc2b G T 17: 33,137,472 A442E probably damaging Het
Moxd2 A T 6: 40,878,810 L615Q probably damaging Het
Msh2 G A 17: 87,708,583 G548S probably damaging Het
Napg G A 18: 62,994,983 S279N possibly damaging Het
Ncor1 A T 11: 62,349,310 probably null Het
Nkiras2 G T 11: 100,626,040 R128L probably damaging Het
Npy4r T C 14: 34,146,707 D208G probably benign Het
Olfr1333 C T 4: 118,830,216 V75I probably benign Het
Olfr589 A G 7: 103,154,874 V291A possibly damaging Het
Olfr901 G T 9: 38,430,331 L16F probably damaging Het
Pcdhgb2 A G 18: 37,690,507 T184A probably benign Het
Plxna4 T C 6: 32,251,065 probably null Het
Pnldc1 C T 17: 12,894,373 E328K probably benign Het
Pon1 T A 6: 5,185,334 L55F probably damaging Het
Prkci G T 3: 31,038,456 D296Y probably damaging Het
Prkd1 T C 12: 50,388,255 H563R probably damaging Het
Ptpru T C 4: 131,818,925 N266S probably benign Het
Rapgef6 A T 11: 54,639,783 I589F probably damaging Het
Rcan3 A T 4: 135,418,542 S127T probably benign Het
Sh3tc2 A G 18: 61,977,904 D277G probably benign Het
Sipa1l3 G A 7: 29,399,524 A440V probably benign Het
Slc13a2 A C 11: 78,400,532 I372S probably damaging Het
Spns1 A T 7: 126,370,323 I528N probably damaging Het
Sult6b2 T C 6: 142,790,295 K191R probably benign Het
Swt1 A G 1: 151,402,949 probably null Het
Tmem131l C T 3: 83,922,246 A1035T possibly damaging Het
Trpc4 A G 3: 54,315,842 E733G probably damaging Het
Uap1l1 A T 2: 25,364,630 H184Q possibly damaging Het
Vil1 T G 1: 74,416,033 V48G possibly damaging Het
Vps39 A T 2: 120,328,705 H367Q probably damaging Het
Wars2 A G 3: 99,187,646 T86A probably benign Het
Wdr90 A G 17: 25,845,133 S1872P probably damaging Het
Wdr90 A G 17: 25,846,407 L1625P probably damaging Het
Xaf1 A T 11: 72,303,430 M46L probably damaging Het
Other mutations in Tcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01962:Tcn2 APN 11 3925072 missense probably benign
IGL02311:Tcn2 APN 11 3917692 missense probably damaging 1.00
IGL02614:Tcn2 APN 11 3926158 missense possibly damaging 0.91
IGL02655:Tcn2 APN 11 3926158 missense possibly damaging 0.91
IGL02679:Tcn2 APN 11 3927504 missense possibly damaging 0.93
IGL02752:Tcn2 APN 11 3926158 missense possibly damaging 0.91
R0265:Tcn2 UTSW 11 3922044 missense probably damaging 1.00
R0845:Tcn2 UTSW 11 3919349 missense probably benign
R1255:Tcn2 UTSW 11 3922120 missense probably benign 0.16
R1459:Tcn2 UTSW 11 3927516 missense probably benign 0.01
R1696:Tcn2 UTSW 11 3922169 missense probably damaging 1.00
R4209:Tcn2 UTSW 11 3922114 missense possibly damaging 0.91
R4210:Tcn2 UTSW 11 3922114 missense possibly damaging 0.91
R4211:Tcn2 UTSW 11 3922114 missense possibly damaging 0.91
R5357:Tcn2 UTSW 11 3926017 missense possibly damaging 0.91
R6973:Tcn2 UTSW 11 3917649 makesense probably null
R7479:Tcn2 UTSW 11 3917703 missense probably damaging 1.00
R8023:Tcn2 UTSW 11 3927579 missense possibly damaging 0.95
T0975:Tcn2 UTSW 11 3923487 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CTTGGATCAAGTCACTGGGGAAG -3'
(R):5'- CCACCTTTCACCATAGAGGG -3'

Sequencing Primer
(F):5'- GACAAGAGACTAGCAATACCGCAG -3'
(R):5'- ACCATAGAGGGCATTTCTCCTGG -3'
Posted On2017-03-31