Incidental Mutation 'R5973:Ncor1'
ID471556
Institutional Source Beutler Lab
Gene Symbol Ncor1
Ensembl Gene ENSMUSG00000018501
Gene Namenuclear receptor co-repressor 1
Synonyms5730405M06Rik, A230020K14Rik, Rxrip13, N-CoR
MMRRC Submission 044156-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5973 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location62316426-62458541 bp(-) (GRCm38)
Type of Mutationintron (43 bp from exon)
DNA Base Change (assembly) A to T at 62349310 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018645] [ENSMUST00000037575] [ENSMUST00000101066] [ENSMUST00000101067] [ENSMUST00000151498] [ENSMUST00000155712]
Predicted Effect probably null
Transcript: ENSMUST00000018645
SMART Domains Protein: ENSMUSP00000018645
Gene: ENSMUSG00000018501

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
Pfam:GPS2_interact 150 239 1.4e-37 PFAM
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 710 731 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 987 995 N/A INTRINSIC
low complexity region 1002 1013 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
internal_repeat_2 1061 1298 1.62e-6 PROSPERO
internal_repeat_2 1299 1515 1.62e-6 PROSPERO
low complexity region 1516 1527 N/A INTRINSIC
coiled coil region 1712 1749 N/A INTRINSIC
low complexity region 1834 1848 N/A INTRINSIC
low complexity region 1969 1980 N/A INTRINSIC
low complexity region 2036 2055 N/A INTRINSIC
PDB:3N00|B 2064 2084 4e-7 PDB
low complexity region 2086 2101 N/A INTRINSIC
low complexity region 2157 2168 N/A INTRINSIC
PDB:2OVM|B 2267 2290 2e-8 PDB
low complexity region 2311 2324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037575
SMART Domains Protein: ENSMUSP00000038900
Gene: ENSMUSG00000018501

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
coiled coil region 658 695 N/A INTRINSIC
low complexity region 780 794 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 982 1001 N/A INTRINSIC
PDB:3N00|B 1010 1030 2e-7 PDB
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
PDB:2OVM|B 1212 1235 2e-8 PDB
low complexity region 1256 1269 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101066
SMART Domains Protein: ENSMUSP00000098627
Gene: ENSMUSG00000018501

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 710 731 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 987 995 N/A INTRINSIC
low complexity region 1002 1013 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
internal_repeat_2 1061 1298 1.62e-6 PROSPERO
internal_repeat_2 1299 1515 1.62e-6 PROSPERO
low complexity region 1516 1527 N/A INTRINSIC
coiled coil region 1712 1749 N/A INTRINSIC
low complexity region 1834 1848 N/A INTRINSIC
low complexity region 1969 1980 N/A INTRINSIC
low complexity region 2036 2055 N/A INTRINSIC
PDB:3N00|B 2064 2084 4e-7 PDB
low complexity region 2086 2101 N/A INTRINSIC
low complexity region 2157 2168 N/A INTRINSIC
PDB:2OVM|B 2267 2290 2e-8 PDB
low complexity region 2311 2324 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101067
SMART Domains Protein: ENSMUSP00000098628
Gene: ENSMUSG00000018501

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 716 734 N/A INTRINSIC
low complexity region 838 849 N/A INTRINSIC
low complexity region 937 945 N/A INTRINSIC
low complexity region 952 963 N/A INTRINSIC
low complexity region 986 999 N/A INTRINSIC
low complexity region 1448 1459 N/A INTRINSIC
coiled coil region 1645 1682 N/A INTRINSIC
low complexity region 1767 1781 N/A INTRINSIC
low complexity region 1902 1913 N/A INTRINSIC
low complexity region 1969 1988 N/A INTRINSIC
PDB:3N00|B 1997 2017 4e-7 PDB
low complexity region 2019 2034 N/A INTRINSIC
low complexity region 2089 2100 N/A INTRINSIC
PDB:2OVM|B 2199 2222 2e-8 PDB
low complexity region 2243 2256 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000151498
SMART Domains Protein: ENSMUSP00000125317
Gene: ENSMUSG00000018501

DomainStartEndE-ValueType
SANT 37 85 2.76e-7 SMART
coiled coil region 107 144 N/A INTRINSIC
low complexity region 193 217 N/A INTRINSIC
SANT 224 272 3.29e-14 SMART
low complexity region 316 337 N/A INTRINSIC
low complexity region 361 378 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 577 585 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
internal_repeat_2 700 830 5.77e-7 PROSPERO
internal_repeat_2 855 961 5.77e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000155712
SMART Domains Protein: ENSMUSP00000122654
Gene: ENSMUSG00000018501

DomainStartEndE-ValueType
low complexity region 26 47 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
low complexity region 303 311 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 352 365 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
coiled coil region 982 1019 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
low complexity region 1239 1250 N/A INTRINSIC
low complexity region 1306 1325 N/A INTRINSIC
PDB:3N00|B 1334 1354 3e-7 PDB
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1427 1438 N/A INTRINSIC
PDB:2OVM|B 1537 1560 2e-8 PDB
low complexity region 1581 1594 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156740
SMART Domains Protein: ENSMUSP00000125458
Gene: ENSMUSG00000018501

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
coiled coil region 647 684 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
low complexity region 905 916 N/A INTRINSIC
low complexity region 972 991 N/A INTRINSIC
PDB:3N00|B 1000 1020 2e-7 PDB
low complexity region 1022 1037 N/A INTRINSIC
low complexity region 1092 1103 N/A INTRINSIC
PDB:2OVM|B 1202 1225 2e-8 PDB
low complexity region 1246 1259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161432
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that mediates ligand-independent transcription repression of thyroid-hormone and retinoic-acid receptors by promoting chromatin condensation and preventing access of the transcription machinery. It is part of a complex which also includes histone deacetylases and transcriptional regulators similar to the yeast protein Sin3p. This gene is located between the Charcot-Marie-Tooth and Smith-Magenis syndrome critical regions on chromosome 17. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 17 and 20.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene exhibit embryonic lethality with erythrocytic, thymocytic and central nervous system development abnormalities. Mice homozygous for a hypomorphic allele exhibit increased thyroid hormone sensitivity under hypothyroid conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,226,867 I1536N probably damaging Het
Actr1b A G 1: 36,702,081 S140P probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc7 A T 5: 122,428,303 T92S probably benign Het
Ash2l G A 8: 25,817,614 T585M possibly damaging Het
Asxl1 T C 2: 153,402,011 F1495L probably damaging Het
Atp5j T C 16: 84,828,440 probably null Het
Bcl2a1c A G 9: 114,330,397 N81S probably benign Het
Bfsp2 A C 9: 103,432,657 probably null Het
Casq1 A G 1: 172,219,501 Y64H probably damaging Het
Ceacam16 A G 7: 19,856,337 V227A probably damaging Het
Cers6 T A 2: 69,068,625 probably null Het
Chrnb1 A G 11: 69,795,845 probably benign Het
Clpb G A 7: 101,663,997 V63I probably benign Het
Dnah11 G T 12: 118,110,952 D1388E probably benign Het
Dst T C 1: 34,156,857 L405P probably damaging Het
Dstyk A G 1: 132,434,411 E193G probably damaging Het
Dusp2 A T 2: 127,337,288 S188C probably damaging Het
Ep400 T C 5: 110,729,831 I810V unknown Het
Faim2 C T 15: 99,521,251 G79D probably benign Het
Fpgt A T 3: 155,087,403 I329K probably damaging Het
Fut8 A G 12: 77,364,997 T78A probably benign Het
Gm10436 T C 12: 88,175,913 I312V probably benign Het
Gm14124 A G 2: 150,267,935 T182A unknown Het
Gm15130 A G 2: 111,135,369 probably benign Het
Gm17087 A C 17: 8,566,697 I58R probably benign Het
Gm5724 T A 6: 141,754,456 T117S probably benign Het
Grk2 T C 19: 4,287,897 D485G possibly damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hmcn1 A G 1: 150,563,817 S5539P probably damaging Het
Hmcn2 G A 2: 31,420,323 V3310M probably damaging Het
Impdh1 A T 6: 29,207,162 L61Q probably damaging Het
Inhbb A T 1: 119,418,076 V161D possibly damaging Het
Kansl2 C T 15: 98,529,425 V192M probably damaging Het
Krt2 T C 15: 101,816,312 K288E probably damaging Het
Lyar A G 5: 38,227,946 K110R probably damaging Het
Lyrm9 C A 11: 78,836,135 H35N probably damaging Het
Mab21l1 A G 3: 55,783,112 D40G probably benign Het
Maml2 A C 9: 13,621,619 probably benign Het
Mbd5 A G 2: 49,272,389 H69R probably benign Het
Morc2b G T 17: 33,137,472 A442E probably damaging Het
Moxd2 A T 6: 40,878,810 L615Q probably damaging Het
Msh2 G A 17: 87,708,583 G548S probably damaging Het
Napg G A 18: 62,994,983 S279N possibly damaging Het
Nkiras2 G T 11: 100,626,040 R128L probably damaging Het
Npy4r T C 14: 34,146,707 D208G probably benign Het
Olfr1333 C T 4: 118,830,216 V75I probably benign Het
Olfr589 A G 7: 103,154,874 V291A possibly damaging Het
Olfr901 G T 9: 38,430,331 L16F probably damaging Het
Pcdhgb2 A G 18: 37,690,507 T184A probably benign Het
Plxna4 T C 6: 32,251,065 probably null Het
Pnldc1 C T 17: 12,894,373 E328K probably benign Het
Pon1 T A 6: 5,185,334 L55F probably damaging Het
Prkci G T 3: 31,038,456 D296Y probably damaging Het
Prkd1 T C 12: 50,388,255 H563R probably damaging Het
Ptpru T C 4: 131,818,925 N266S probably benign Het
Rapgef6 A T 11: 54,639,783 I589F probably damaging Het
Rcan3 A T 4: 135,418,542 S127T probably benign Het
Sh3tc2 A G 18: 61,977,904 D277G probably benign Het
Sipa1l3 G A 7: 29,399,524 A440V probably benign Het
Slc13a2 A C 11: 78,400,532 I372S probably damaging Het
Spns1 A T 7: 126,370,323 I528N probably damaging Het
Sult6b2 T C 6: 142,790,295 K191R probably benign Het
Swt1 A G 1: 151,402,949 probably null Het
Tcn2 A T 11: 3,927,546 L34* probably null Het
Tmem131l C T 3: 83,922,246 A1035T possibly damaging Het
Trpc4 A G 3: 54,315,842 E733G probably damaging Het
Uap1l1 A T 2: 25,364,630 H184Q possibly damaging Het
Vil1 T G 1: 74,416,033 V48G possibly damaging Het
Vps39 A T 2: 120,328,705 H367Q probably damaging Het
Wars2 A G 3: 99,187,646 T86A probably benign Het
Wdr90 A G 17: 25,845,133 S1872P probably damaging Het
Wdr90 A G 17: 25,846,407 L1625P probably damaging Het
Xaf1 A T 11: 72,303,430 M46L probably damaging Het
Other mutations in Ncor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Ncor1 APN 11 62392528 missense probably damaging 1.00
IGL01343:Ncor1 APN 11 62325486 critical splice donor site probably null
IGL01392:Ncor1 APN 11 62340594 missense probably damaging 0.99
IGL01402:Ncor1 APN 11 62340474 missense probably damaging 1.00
IGL01714:Ncor1 APN 11 62334584 missense possibly damaging 0.58
IGL01772:Ncor1 APN 11 62349347 intron probably benign
IGL01889:Ncor1 APN 11 62334601 missense possibly damaging 0.69
IGL02058:Ncor1 APN 11 62344637 missense probably damaging 1.00
IGL02065:Ncor1 APN 11 62419609 missense possibly damaging 0.95
IGL02073:Ncor1 APN 11 62358917 missense probably damaging 0.99
IGL02176:Ncor1 APN 11 62329659 unclassified probably benign
IGL02288:Ncor1 APN 11 62349403 missense probably benign 0.01
IGL02348:Ncor1 APN 11 62333659 splice site probably benign
IGL02608:Ncor1 APN 11 62373214 missense probably benign 0.07
LCD18:Ncor1 UTSW 11 62419782 critical splice acceptor site probably benign
PIT4382001:Ncor1 UTSW 11 62344663 missense probably damaging 0.96
PIT4576001:Ncor1 UTSW 11 62333717 missense probably damaging 0.99
R0026:Ncor1 UTSW 11 62438429 missense probably damaging 1.00
R0038:Ncor1 UTSW 11 62392551 missense probably damaging 0.99
R0038:Ncor1 UTSW 11 62392551 missense probably damaging 0.99
R0103:Ncor1 UTSW 11 62343045 missense possibly damaging 0.85
R0103:Ncor1 UTSW 11 62343045 missense possibly damaging 0.85
R0144:Ncor1 UTSW 11 62392595 missense probably damaging 1.00
R0427:Ncor1 UTSW 11 62410920 missense probably damaging 1.00
R0501:Ncor1 UTSW 11 62373322 missense possibly damaging 0.73
R0544:Ncor1 UTSW 11 62333776 missense probably damaging 1.00
R0544:Ncor1 UTSW 11 62333777 missense probably damaging 1.00
R0563:Ncor1 UTSW 11 62343230 missense probably damaging 0.97
R1074:Ncor1 UTSW 11 62392551 missense probably damaging 0.99
R1266:Ncor1 UTSW 11 62334040 missense probably damaging 0.98
R1444:Ncor1 UTSW 11 62403806 missense probably damaging 1.00
R1452:Ncor1 UTSW 11 62334631 missense probably damaging 1.00
R1534:Ncor1 UTSW 11 62378504 missense possibly damaging 0.92
R1710:Ncor1 UTSW 11 62423005 missense probably damaging 1.00
R1762:Ncor1 UTSW 11 62384784 missense possibly damaging 0.82
R1771:Ncor1 UTSW 11 62327112 missense probably damaging 1.00
R1864:Ncor1 UTSW 11 62381419 missense probably damaging 1.00
R1902:Ncor1 UTSW 11 62338158 missense probably damaging 1.00
R1906:Ncor1 UTSW 11 62349385 missense possibly damaging 0.81
R2009:Ncor1 UTSW 11 62325601 missense probably benign 0.43
R3708:Ncor1 UTSW 11 62344687 missense probably damaging 1.00
R3825:Ncor1 UTSW 11 62373357 missense probably benign 0.00
R3923:Ncor1 UTSW 11 62325616 missense probably damaging 1.00
R3966:Ncor1 UTSW 11 62344757 missense probably damaging 1.00
R4049:Ncor1 UTSW 11 62329668 intron probably null
R4350:Ncor1 UTSW 11 62410818 critical splice donor site probably null
R4351:Ncor1 UTSW 11 62410818 critical splice donor site probably null
R4359:Ncor1 UTSW 11 62358910 missense probably damaging 1.00
R4712:Ncor1 UTSW 11 62344834 missense probably damaging 1.00
R4723:Ncor1 UTSW 11 62378612 missense probably benign 0.26
R4863:Ncor1 UTSW 11 62392638 missense possibly damaging 0.92
R4875:Ncor1 UTSW 11 62433611 small deletion probably benign
R4956:Ncor1 UTSW 11 62340605 missense probably damaging 1.00
R4993:Ncor1 UTSW 11 62343341 missense probably damaging 1.00
R5079:Ncor1 UTSW 11 62345237 missense possibly damaging 0.92
R5144:Ncor1 UTSW 11 62349464 missense probably damaging 1.00
R5223:Ncor1 UTSW 11 62339000 missense probably damaging 1.00
R5243:Ncor1 UTSW 11 62338962 missense probably damaging 1.00
R5271:Ncor1 UTSW 11 62340545 missense probably damaging 1.00
R5285:Ncor1 UTSW 11 62392649 missense probably damaging 1.00
R5533:Ncor1 UTSW 11 62343011 missense probably benign 0.00
R5580:Ncor1 UTSW 11 62389778 nonsense probably null
R5593:Ncor1 UTSW 11 62369304 missense probably damaging 1.00
R5609:Ncor1 UTSW 11 62358853 unclassified probably null
R5632:Ncor1 UTSW 11 62338234 missense possibly damaging 0.85
R5830:Ncor1 UTSW 11 62344763 missense possibly damaging 0.71
R5896:Ncor1 UTSW 11 62383190 missense probably damaging 1.00
R6013:Ncor1 UTSW 11 62321077 missense probably benign
R6019:Ncor1 UTSW 11 62373161 missense probably benign 0.00
R6032:Ncor1 UTSW 11 62373321 missense possibly damaging 0.54
R6032:Ncor1 UTSW 11 62373321 missense possibly damaging 0.54
R6075:Ncor1 UTSW 11 62317849 missense probably damaging 1.00
R6091:Ncor1 UTSW 11 62419617 missense probably damaging 0.98
R6248:Ncor1 UTSW 11 62366982 missense probably damaging 1.00
R6281:Ncor1 UTSW 11 62373545 missense possibly damaging 0.71
R6351:Ncor1 UTSW 11 62373298 missense probably benign 0.30
R6469:Ncor1 UTSW 11 62343302 missense probably damaging 1.00
R6502:Ncor1 UTSW 11 62381414 nonsense probably null
R6614:Ncor1 UTSW 11 62330819 missense probably benign 0.01
R6650:Ncor1 UTSW 11 62334541 missense probably damaging 1.00
R6765:Ncor1 UTSW 11 62373446 missense probably benign 0.01
R6852:Ncor1 UTSW 11 62343245 missense probably damaging 0.97
R6909:Ncor1 UTSW 11 62329486 missense probably damaging 1.00
R6965:Ncor1 UTSW 11 62353233 critical splice donor site probably null
R7054:Ncor1 UTSW 11 62384793 missense probably null
R7248:Ncor1 UTSW 11 62384772 missense possibly damaging 0.89
R7352:Ncor1 UTSW 11 62333911 missense probably damaging 0.99
R7396:Ncor1 UTSW 11 62343218 missense probably damaging 0.99
R7434:Ncor1 UTSW 11 62383199 missense probably damaging 0.99
R7552:Ncor1 UTSW 11 62373424 missense possibly damaging 0.53
R7565:Ncor1 UTSW 11 62401265 missense probably damaging 1.00
R7575:Ncor1 UTSW 11 62383256 missense probably benign 0.21
R7622:Ncor1 UTSW 11 62317968 missense probably benign 0.00
R7664:Ncor1 UTSW 11 62398328 missense probably damaging 1.00
R7814:Ncor1 UTSW 11 62333926 missense probably damaging 0.99
X0065:Ncor1 UTSW 11 62354569 critical splice donor site probably null
X0065:Ncor1 UTSW 11 62358991 missense probably benign 0.23
Z1176:Ncor1 UTSW 11 62438516 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATTCTTAGATTCACTGAACCAGGAGG -3'
(R):5'- CTACAGATATTAAGAATGCCCGAGAAG -3'

Sequencing Primer
(F):5'- CCAGGAGGTAGTTCTACAATAGC -3'
(R):5'- AAGCAAGGCATGTCGATG -3'
Posted On2017-03-31