Incidental Mutation 'R5973:Xaf1'
ID471558
Institutional Source Beutler Lab
Gene Symbol Xaf1
Ensembl Gene ENSMUSG00000040483
Gene NameXIAP associated factor 1
Synonyms
MMRRC Submission 044156-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5973 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location72301629-72313733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72303430 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 46 (M46L)
Ref Sequence ENSEMBL: ENSMUSP00000121483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094041] [ENSMUST00000140842] [ENSMUST00000146233] [ENSMUST00000151440]
Predicted Effect probably damaging
Transcript: ENSMUST00000094041
AA Change: M46L

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000140842
AA Change: M46L

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000121472
Gene: ENSMUSG00000040483
AA Change: M46L

DomainStartEndE-ValueType
PDB:2LXW|A 133 175 7e-13 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142921
Predicted Effect possibly damaging
Transcript: ENSMUST00000146233
AA Change: M46L

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123011
Gene: ENSMUSG00000040483
AA Change: M46L

DomainStartEndE-ValueType
PDB:2LXW|A 228 270 3e-12 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000151440
AA Change: M46L

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121483
Gene: ENSMUSG00000040483
AA Change: M46L

DomainStartEndE-ValueType
PDB:2LXW|A 133 165 7e-9 PDB
low complexity region 194 205 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which binds to and counteracts the inhibitory effect of a member of the IAP (inhibitor of apoptosis) protein family. IAP proteins bind to and inhibit caspases which are activated during apoptosis. The proportion of IAPs and proteins which interfere with their activity, such as the encoded protein, affect the progress of the apoptosis signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,226,867 I1536N probably damaging Het
Actr1b A G 1: 36,702,081 S140P probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc7 A T 5: 122,428,303 T92S probably benign Het
Ash2l G A 8: 25,817,614 T585M possibly damaging Het
Asxl1 T C 2: 153,402,011 F1495L probably damaging Het
Atp5j T C 16: 84,828,440 probably null Het
Bcl2a1c A G 9: 114,330,397 N81S probably benign Het
Bfsp2 A C 9: 103,432,657 probably null Het
Casq1 A G 1: 172,219,501 Y64H probably damaging Het
Ceacam16 A G 7: 19,856,337 V227A probably damaging Het
Cers6 T A 2: 69,068,625 probably null Het
Chrnb1 A G 11: 69,795,845 probably benign Het
Clpb G A 7: 101,663,997 V63I probably benign Het
Dnah11 G T 12: 118,110,952 D1388E probably benign Het
Dst T C 1: 34,156,857 L405P probably damaging Het
Dstyk A G 1: 132,434,411 E193G probably damaging Het
Dusp2 A T 2: 127,337,288 S188C probably damaging Het
Ep400 T C 5: 110,729,831 I810V unknown Het
Faim2 C T 15: 99,521,251 G79D probably benign Het
Fpgt A T 3: 155,087,403 I329K probably damaging Het
Fut8 A G 12: 77,364,997 T78A probably benign Het
Gm10436 T C 12: 88,175,913 I312V probably benign Het
Gm14124 A G 2: 150,267,935 T182A unknown Het
Gm15130 A G 2: 111,135,369 probably benign Het
Gm17087 A C 17: 8,566,697 I58R probably benign Het
Gm5724 T A 6: 141,754,456 T117S probably benign Het
Grk2 T C 19: 4,287,897 D485G possibly damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hmcn1 A G 1: 150,563,817 S5539P probably damaging Het
Hmcn2 G A 2: 31,420,323 V3310M probably damaging Het
Impdh1 A T 6: 29,207,162 L61Q probably damaging Het
Inhbb A T 1: 119,418,076 V161D possibly damaging Het
Kansl2 C T 15: 98,529,425 V192M probably damaging Het
Krt2 T C 15: 101,816,312 K288E probably damaging Het
Lyar A G 5: 38,227,946 K110R probably damaging Het
Lyrm9 C A 11: 78,836,135 H35N probably damaging Het
Mab21l1 A G 3: 55,783,112 D40G probably benign Het
Maml2 A C 9: 13,621,619 probably benign Het
Mbd5 A G 2: 49,272,389 H69R probably benign Het
Morc2b G T 17: 33,137,472 A442E probably damaging Het
Moxd2 A T 6: 40,878,810 L615Q probably damaging Het
Msh2 G A 17: 87,708,583 G548S probably damaging Het
Napg G A 18: 62,994,983 S279N possibly damaging Het
Ncor1 A T 11: 62,349,310 probably null Het
Nkiras2 G T 11: 100,626,040 R128L probably damaging Het
Npy4r T C 14: 34,146,707 D208G probably benign Het
Olfr1333 C T 4: 118,830,216 V75I probably benign Het
Olfr589 A G 7: 103,154,874 V291A possibly damaging Het
Olfr901 G T 9: 38,430,331 L16F probably damaging Het
Pcdhgb2 A G 18: 37,690,507 T184A probably benign Het
Plxna4 T C 6: 32,251,065 probably null Het
Pnldc1 C T 17: 12,894,373 E328K probably benign Het
Pon1 T A 6: 5,185,334 L55F probably damaging Het
Prkci G T 3: 31,038,456 D296Y probably damaging Het
Prkd1 T C 12: 50,388,255 H563R probably damaging Het
Ptpru T C 4: 131,818,925 N266S probably benign Het
Rapgef6 A T 11: 54,639,783 I589F probably damaging Het
Rcan3 A T 4: 135,418,542 S127T probably benign Het
Sh3tc2 A G 18: 61,977,904 D277G probably benign Het
Sipa1l3 G A 7: 29,399,524 A440V probably benign Het
Slc13a2 A C 11: 78,400,532 I372S probably damaging Het
Spns1 A T 7: 126,370,323 I528N probably damaging Het
Sult6b2 T C 6: 142,790,295 K191R probably benign Het
Swt1 A G 1: 151,402,949 probably null Het
Tcn2 A T 11: 3,927,546 L34* probably null Het
Tmem131l C T 3: 83,922,246 A1035T possibly damaging Het
Trpc4 A G 3: 54,315,842 E733G probably damaging Het
Uap1l1 A T 2: 25,364,630 H184Q possibly damaging Het
Vil1 T G 1: 74,416,033 V48G possibly damaging Het
Vps39 A T 2: 120,328,705 H367Q probably damaging Het
Wars2 A G 3: 99,187,646 T86A probably benign Het
Wdr90 A G 17: 25,845,133 S1872P probably damaging Het
Wdr90 A G 17: 25,846,407 L1625P probably damaging Het
Other mutations in Xaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02457:Xaf1 APN 11 72303431 missense possibly damaging 0.80
R0230:Xaf1 UTSW 11 72306555 intron probably benign
R1955:Xaf1 UTSW 11 72306606 missense possibly damaging 0.81
R2206:Xaf1 UTSW 11 72303402 missense possibly damaging 0.85
R2207:Xaf1 UTSW 11 72303402 missense possibly damaging 0.85
R4864:Xaf1 UTSW 11 72306856 intron probably benign
R6463:Xaf1 UTSW 11 72308638 missense probably benign 0.01
R6786:Xaf1 UTSW 11 72306635 missense probably benign 0.00
R7199:Xaf1 UTSW 11 72303375 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAACAAGGCGTCATGTC -3'
(R):5'- CTTTGTTCTGCCAGACCCATAG -3'

Sequencing Primer
(F):5'- CAACAAGGCGTCATGTCTTATGC -3'
(R):5'- CCATAGTCTTGGGGTAGCAAG -3'
Posted On2017-03-31