Incidental Mutation 'R5973:Npy4r'
ID471565
Institutional Source Beutler Lab
Gene Symbol Npy4r
Ensembl Gene ENSMUSG00000048337
Gene Nameneuropeptide Y receptor Y4
SynonymsNYYR-D, Y4, Ppyr1
MMRRC Submission 044156-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R5973 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location34143992-34152489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34146707 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 208 (D208G)
Ref Sequence ENSEMBL: ENSMUSP00000056576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052164]
Predicted Effect probably benign
Transcript: ENSMUST00000052164
AA Change: D208G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000056576
Gene: ENSMUSG00000048337
AA Change: D208G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 52 337 2.5e-6 PFAM
Pfam:7tm_1 58 322 1.6e-48 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased weight, increased drinking behavior, decreased food intake, aggression towards other mice, decreased white adipose tissue, and accelerated lobuloalveolar development during pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,226,867 I1536N probably damaging Het
Actr1b A G 1: 36,702,081 S140P probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc7 A T 5: 122,428,303 T92S probably benign Het
Ash2l G A 8: 25,817,614 T585M possibly damaging Het
Asxl1 T C 2: 153,402,011 F1495L probably damaging Het
Atp5j T C 16: 84,828,440 probably null Het
Bcl2a1c A G 9: 114,330,397 N81S probably benign Het
Bfsp2 A C 9: 103,432,657 probably null Het
Casq1 A G 1: 172,219,501 Y64H probably damaging Het
Ceacam16 A G 7: 19,856,337 V227A probably damaging Het
Cers6 T A 2: 69,068,625 probably null Het
Chrnb1 A G 11: 69,795,845 probably benign Het
Clpb G A 7: 101,663,997 V63I probably benign Het
Dnah11 G T 12: 118,110,952 D1388E probably benign Het
Dst T C 1: 34,156,857 L405P probably damaging Het
Dstyk A G 1: 132,434,411 E193G probably damaging Het
Dusp2 A T 2: 127,337,288 S188C probably damaging Het
Ep400 T C 5: 110,729,831 I810V unknown Het
Faim2 C T 15: 99,521,251 G79D probably benign Het
Fpgt A T 3: 155,087,403 I329K probably damaging Het
Fut8 A G 12: 77,364,997 T78A probably benign Het
Gm10436 T C 12: 88,175,913 I312V probably benign Het
Gm14124 A G 2: 150,267,935 T182A unknown Het
Gm15130 A G 2: 111,135,369 probably benign Het
Gm17087 A C 17: 8,566,697 I58R probably benign Het
Gm5724 T A 6: 141,754,456 T117S probably benign Het
Grk2 T C 19: 4,287,897 D485G possibly damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hmcn1 A G 1: 150,563,817 S5539P probably damaging Het
Hmcn2 G A 2: 31,420,323 V3310M probably damaging Het
Impdh1 A T 6: 29,207,162 L61Q probably damaging Het
Inhbb A T 1: 119,418,076 V161D possibly damaging Het
Kansl2 C T 15: 98,529,425 V192M probably damaging Het
Krt2 T C 15: 101,816,312 K288E probably damaging Het
Lyar A G 5: 38,227,946 K110R probably damaging Het
Lyrm9 C A 11: 78,836,135 H35N probably damaging Het
Mab21l1 A G 3: 55,783,112 D40G probably benign Het
Maml2 A C 9: 13,621,619 probably benign Het
Mbd5 A G 2: 49,272,389 H69R probably benign Het
Morc2b G T 17: 33,137,472 A442E probably damaging Het
Moxd2 A T 6: 40,878,810 L615Q probably damaging Het
Msh2 G A 17: 87,708,583 G548S probably damaging Het
Napg G A 18: 62,994,983 S279N possibly damaging Het
Ncor1 A T 11: 62,349,310 probably null Het
Nkiras2 G T 11: 100,626,040 R128L probably damaging Het
Olfr1333 C T 4: 118,830,216 V75I probably benign Het
Olfr589 A G 7: 103,154,874 V291A possibly damaging Het
Olfr901 G T 9: 38,430,331 L16F probably damaging Het
Pcdhgb2 A G 18: 37,690,507 T184A probably benign Het
Plxna4 T C 6: 32,251,065 probably null Het
Pnldc1 C T 17: 12,894,373 E328K probably benign Het
Pon1 T A 6: 5,185,334 L55F probably damaging Het
Prkci G T 3: 31,038,456 D296Y probably damaging Het
Prkd1 T C 12: 50,388,255 H563R probably damaging Het
Ptpru T C 4: 131,818,925 N266S probably benign Het
Rapgef6 A T 11: 54,639,783 I589F probably damaging Het
Rcan3 A T 4: 135,418,542 S127T probably benign Het
Sh3tc2 A G 18: 61,977,904 D277G probably benign Het
Sipa1l3 G A 7: 29,399,524 A440V probably benign Het
Slc13a2 A C 11: 78,400,532 I372S probably damaging Het
Spns1 A T 7: 126,370,323 I528N probably damaging Het
Sult6b2 T C 6: 142,790,295 K191R probably benign Het
Swt1 A G 1: 151,402,949 probably null Het
Tcn2 A T 11: 3,927,546 L34* probably null Het
Tmem131l C T 3: 83,922,246 A1035T possibly damaging Het
Trpc4 A G 3: 54,315,842 E733G probably damaging Het
Uap1l1 A T 2: 25,364,630 H184Q possibly damaging Het
Vil1 T G 1: 74,416,033 V48G possibly damaging Het
Vps39 A T 2: 120,328,705 H367Q probably damaging Het
Wars2 A G 3: 99,187,646 T86A probably benign Het
Wdr90 A G 17: 25,845,133 S1872P probably damaging Het
Wdr90 A G 17: 25,846,407 L1625P probably damaging Het
Xaf1 A T 11: 72,303,430 M46L probably damaging Het
Other mutations in Npy4r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Npy4r APN 14 34146657 missense possibly damaging 0.56
IGL01449:Npy4r APN 14 34146365 missense probably damaging 1.00
IGL01982:Npy4r APN 14 34147325 missense possibly damaging 0.73
IGL03126:Npy4r APN 14 34146333 missense probably benign 0.00
R0011:Npy4r UTSW 14 34146723 missense probably damaging 0.99
R0011:Npy4r UTSW 14 34146723 missense probably damaging 0.99
R0579:Npy4r UTSW 14 34146683 missense probably benign 0.16
R2012:Npy4r UTSW 14 34147197 missense possibly damaging 0.58
R3735:Npy4r UTSW 14 34147269 missense probably benign 0.00
R4093:Npy4r UTSW 14 34147141 missense probably benign 0.21
R4650:Npy4r UTSW 14 34146224 missense possibly damaging 0.55
R4861:Npy4r UTSW 14 34146883 nonsense probably null
R4861:Npy4r UTSW 14 34146883 nonsense probably null
R4953:Npy4r UTSW 14 34146480 missense probably damaging 1.00
R4963:Npy4r UTSW 14 34147016 missense probably damaging 1.00
R5387:Npy4r UTSW 14 34146983 missense probably benign 0.21
R6948:Npy4r UTSW 14 34146774 missense probably benign
R7251:Npy4r UTSW 14 34146915 missense probably damaging 1.00
R8081:Npy4r UTSW 14 34146567 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAAAGGCAGTCACCATTGTC -3'
(R):5'- CTCATTATCAATCCAACAGGCTGG -3'

Sequencing Primer
(F):5'- GCAGTCACCATTGTCATGAGCATG -3'
(R):5'- GGAAACCCAGTATTTTCCAGGC -3'
Posted On2017-03-31