Incidental Mutation 'R5973:Afg3l2'
ID471579
Institutional Source Beutler Lab
Gene Symbol Afg3l2
Ensembl Gene ENSMUSG00000024527
Gene NameAFG3-like AAA ATPase 2
Synonyms2310036I02Rik, Emv66, par
MMRRC Submission 044156-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5973 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location67404767-67449166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 67421259 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 458 (L458M)
Ref Sequence ENSEMBL: ENSMUSP00000025408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025408]
Predicted Effect probably damaging
Transcript: ENSMUST00000025408
AA Change: L458M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: L458M

DomainStartEndE-ValueType
low complexity region 95 121 N/A INTRINSIC
Pfam:FtsH_ext 144 241 8.8e-12 PFAM
transmembrane domain 251 270 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
AAA 339 478 1.37e-23 SMART
Pfam:Peptidase_M41 540 743 4e-77 PFAM
low complexity region 780 794 N/A INTRINSIC
Meta Mutation Damage Score 0.3865 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,226,867 I1536N probably damaging Het
Actr1b A G 1: 36,702,081 S140P probably damaging Het
Anapc7 A T 5: 122,428,303 T92S probably benign Het
Ash2l G A 8: 25,817,614 T585M possibly damaging Het
Asxl1 T C 2: 153,402,011 F1495L probably damaging Het
Atp5j T C 16: 84,828,440 probably null Het
Bcl2a1c A G 9: 114,330,397 N81S probably benign Het
Bfsp2 A C 9: 103,432,657 probably null Het
Casq1 A G 1: 172,219,501 Y64H probably damaging Het
Ceacam16 A G 7: 19,856,337 V227A probably damaging Het
Cers6 T A 2: 69,068,625 probably null Het
Chrnb1 A G 11: 69,795,845 probably benign Het
Clpb G A 7: 101,663,997 V63I probably benign Het
Dnah11 G T 12: 118,110,952 D1388E probably benign Het
Dst T C 1: 34,156,857 L405P probably damaging Het
Dstyk A G 1: 132,434,411 E193G probably damaging Het
Dusp2 A T 2: 127,337,288 S188C probably damaging Het
Ep400 T C 5: 110,729,831 I810V unknown Het
Faim2 C T 15: 99,521,251 G79D probably benign Het
Fpgt A T 3: 155,087,403 I329K probably damaging Het
Fut8 A G 12: 77,364,997 T78A probably benign Het
Gm10436 T C 12: 88,175,913 I312V probably benign Het
Gm14124 A G 2: 150,267,935 T182A unknown Het
Gm15130 A G 2: 111,135,369 probably benign Het
Gm17087 A C 17: 8,566,697 I58R probably benign Het
Gm5724 T A 6: 141,754,456 T117S probably benign Het
Grk2 T C 19: 4,287,897 D485G possibly damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hmcn1 A G 1: 150,563,817 S5539P probably damaging Het
Hmcn2 G A 2: 31,420,323 V3310M probably damaging Het
Impdh1 A T 6: 29,207,162 L61Q probably damaging Het
Inhbb A T 1: 119,418,076 V161D possibly damaging Het
Kansl2 C T 15: 98,529,425 V192M probably damaging Het
Krt2 T C 15: 101,816,312 K288E probably damaging Het
Lyar A G 5: 38,227,946 K110R probably damaging Het
Lyrm9 C A 11: 78,836,135 H35N probably damaging Het
Mab21l1 A G 3: 55,783,112 D40G probably benign Het
Maml2 A C 9: 13,621,619 probably benign Het
Mbd5 A G 2: 49,272,389 H69R probably benign Het
Morc2b G T 17: 33,137,472 A442E probably damaging Het
Moxd2 A T 6: 40,878,810 L615Q probably damaging Het
Msh2 G A 17: 87,708,583 G548S probably damaging Het
Napg G A 18: 62,994,983 S279N possibly damaging Het
Ncor1 A T 11: 62,349,310 probably null Het
Nkiras2 G T 11: 100,626,040 R128L probably damaging Het
Npy4r T C 14: 34,146,707 D208G probably benign Het
Olfr1333 C T 4: 118,830,216 V75I probably benign Het
Olfr589 A G 7: 103,154,874 V291A possibly damaging Het
Olfr901 G T 9: 38,430,331 L16F probably damaging Het
Pcdhgb2 A G 18: 37,690,507 T184A probably benign Het
Plxna4 T C 6: 32,251,065 probably null Het
Pnldc1 C T 17: 12,894,373 E328K probably benign Het
Pon1 T A 6: 5,185,334 L55F probably damaging Het
Prkci G T 3: 31,038,456 D296Y probably damaging Het
Prkd1 T C 12: 50,388,255 H563R probably damaging Het
Ptpru T C 4: 131,818,925 N266S probably benign Het
Rapgef6 A T 11: 54,639,783 I589F probably damaging Het
Rcan3 A T 4: 135,418,542 S127T probably benign Het
Sh3tc2 A G 18: 61,977,904 D277G probably benign Het
Sipa1l3 G A 7: 29,399,524 A440V probably benign Het
Slc13a2 A C 11: 78,400,532 I372S probably damaging Het
Spns1 A T 7: 126,370,323 I528N probably damaging Het
Sult6b2 T C 6: 142,790,295 K191R probably benign Het
Swt1 A G 1: 151,402,949 probably null Het
Tcn2 A T 11: 3,927,546 L34* probably null Het
Tmem131l C T 3: 83,922,246 A1035T possibly damaging Het
Trpc4 A G 3: 54,315,842 E733G probably damaging Het
Uap1l1 A T 2: 25,364,630 H184Q possibly damaging Het
Vil1 T G 1: 74,416,033 V48G possibly damaging Het
Vps39 A T 2: 120,328,705 H367Q probably damaging Het
Wars2 A G 3: 99,187,646 T86A probably benign Het
Wdr90 A G 17: 25,845,133 S1872P probably damaging Het
Wdr90 A G 17: 25,846,407 L1625P probably damaging Het
Xaf1 A T 11: 72,303,430 M46L probably damaging Het
Other mutations in Afg3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Afg3l2 APN 18 67431653 critical splice donor site probably null
IGL01395:Afg3l2 APN 18 67442810 missense probably benign 0.21
IGL01533:Afg3l2 APN 18 67405418 nonsense probably null
IGL01814:Afg3l2 APN 18 67405474 missense probably benign 0.23
IGL01868:Afg3l2 APN 18 67414148 missense possibly damaging 0.83
IGL02399:Afg3l2 APN 18 67429040 missense possibly damaging 0.82
IGL02827:Afg3l2 APN 18 67425945 missense probably damaging 1.00
IGL03342:Afg3l2 APN 18 67407320 missense probably benign
IGL03392:Afg3l2 APN 18 67414069 splice site probably benign
radicle UTSW 18 67422953 missense probably damaging 1.00
rootlet UTSW 18 67421259 missense probably damaging 1.00
R0057:Afg3l2 UTSW 18 67423086 missense probably damaging 1.00
R0107:Afg3l2 UTSW 18 67431766 missense probably damaging 1.00
R0650:Afg3l2 UTSW 18 67415557 missense possibly damaging 0.77
R0831:Afg3l2 UTSW 18 67421227 missense probably damaging 1.00
R0899:Afg3l2 UTSW 18 67422977 missense possibly damaging 0.65
R0962:Afg3l2 UTSW 18 67405427 missense possibly damaging 0.77
R1672:Afg3l2 UTSW 18 67407423 missense probably benign 0.31
R1815:Afg3l2 UTSW 18 67415573 nonsense probably null
R1838:Afg3l2 UTSW 18 67414172 missense probably damaging 0.99
R2013:Afg3l2 UTSW 18 67431772 missense probably damaging 0.99
R2383:Afg3l2 UTSW 18 67422956 missense possibly damaging 0.91
R2906:Afg3l2 UTSW 18 67440222 missense probably damaging 1.00
R4763:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4765:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4775:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5193:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5196:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5197:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5257:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5361:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5362:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5363:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5397:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5588:Afg3l2 UTSW 18 67440207 missense possibly damaging 0.88
R5605:Afg3l2 UTSW 18 67442355 nonsense probably null
R5696:Afg3l2 UTSW 18 67407459 missense probably damaging 1.00
R5722:Afg3l2 UTSW 18 67440199 missense probably benign 0.44
R5779:Afg3l2 UTSW 18 67440443 missense probably null 0.12
R5972:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5974:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5979:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5994:Afg3l2 UTSW 18 67429070 missense probably damaging 1.00
R6026:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6027:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6028:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6029:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6075:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6077:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6081:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6131:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6132:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6134:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6152:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6154:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6169:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6178:Afg3l2 UTSW 18 67409528 missense possibly damaging 0.91
R6187:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6216:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6718:Afg3l2 UTSW 18 67421276 missense probably damaging 1.00
R7388:Afg3l2 UTSW 18 67422953 missense probably damaging 1.00
Z1176:Afg3l2 UTSW 18 67431707 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GGCACTGTCCAGCTTCAATG -3'
(R):5'- AGTTTACATCTTGATTGTAGCTCCC -3'

Sequencing Primer
(F):5'- TCCAGCTTCAATGGTCGAAG -3'
(R):5'- GATTGTAGCTCCCCTCTCCAG -3'
Posted On2017-03-31