Incidental Mutation 'R5974:Dido1'
ID471595
Institutional Source Beutler Lab
Gene Symbol Dido1
Ensembl Gene ENSMUSG00000038914
Gene Namedeath inducer-obliterator 1
Synonyms6720461J16Rik, DIO-1, Datf1, D130048F08Rik
MMRRC Submission 044157-MU
Accession Numbers

Genbank: NM_175551; MGI: 1344352

Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R5974 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location180657964-180709999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 180671497 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 994 (D994G)
Ref Sequence ENSEMBL: ENSMUSP00000099346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037764] [ENSMUST00000087517] [ENSMUST00000103056] [ENSMUST00000103057]
Predicted Effect probably benign
Transcript: ENSMUST00000037764
AA Change: D454G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000048315
Gene: ENSMUSG00000038914
AA Change: D454G

DomainStartEndE-ValueType
TFS2M 129 230 1.16e-45 SMART
low complexity region 397 422 N/A INTRINSIC
low complexity region 483 497 N/A INTRINSIC
Pfam:SPOC 512 618 4.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087517
AA Change: D994G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000084794
Gene: ENSMUSG00000038914
AA Change: D994G

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
TFS2M 669 770 1.16e-45 SMART
low complexity region 937 962 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
Pfam:SPOC 1052 1158 1e-22 PFAM
low complexity region 1253 1267 N/A INTRINSIC
low complexity region 1279 1308 N/A INTRINSIC
low complexity region 1372 1391 N/A INTRINSIC
coiled coil region 1458 1502 N/A INTRINSIC
low complexity region 1649 1680 N/A INTRINSIC
low complexity region 1748 1766 N/A INTRINSIC
low complexity region 1780 1792 N/A INTRINSIC
low complexity region 1804 1815 N/A INTRINSIC
internal_repeat_2 1816 1852 3.9e-5 PROSPERO
internal_repeat_1 1819 1859 6.92e-7 PROSPERO
internal_repeat_2 1926 1964 3.9e-5 PROSPERO
internal_repeat_1 1940 1982 6.92e-7 PROSPERO
low complexity region 2025 2045 N/A INTRINSIC
low complexity region 2123 2160 N/A INTRINSIC
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2182 2239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103056
AA Change: D994G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099345
Gene: ENSMUSG00000038914
AA Change: D994G

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
TFS2M 669 770 1.16e-45 SMART
low complexity region 937 962 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
Pfam:SPOC 1052 1158 4.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103057
AA Change: D994G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099346
Gene: ENSMUSG00000038914
AA Change: D994G

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
TFS2M 669 770 1.16e-45 SMART
low complexity region 937 962 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
Pfam:SPOC 1052 1158 4.7e-23 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transcription factor involved in apoptosis. The encoded protein functions in cell cycle progression and plays a role in chromosomal stability. This protein regulates the self-renewal of embryonic stem cells. Disruption of this gene in mice causes symptoms similar to myelodysplastic/myeloproliferative diseases in humans. Mice lacking this gene show severely reduced fertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severely reduced fertility; about one-half develop a transplantable disease characterized by anomalies in spleen, bone marrow, and peripheral blood and including anemia and various symptoms typical of myeloid dysplasia or myeloid proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(245) : Targeted, knock-out(1) Gene trapped(244)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc4 T C 5: 52,845,400 L261P probably damaging Het
Aqp6 A G 15: 99,601,436 Y10C probably benign Het
Ccnb1ip1 A T 14: 50,792,205 N133K probably benign Het
Clip4 A T 17: 71,831,247 H433L probably damaging Het
Cntnap5c T A 17: 57,876,485 M62K probably benign Het
Col12a1 A G 9: 79,682,127 S1049P probably damaging Het
Col15a1 C T 4: 47,258,683 T358I probably benign Het
Coro7 A T 16: 4,631,889 D645E possibly damaging Het
Ctnnal1 C A 4: 56,817,067 W585L probably damaging Het
Ctnnd1 C A 2: 84,620,915 E114* probably null Het
Daam2 T A 17: 49,464,473 S882C probably damaging Het
Des T A 1: 75,362,984 S329T probably benign Het
Dock3 A G 9: 106,994,062 V547A probably damaging Het
Ebf4 G A 2: 130,365,564 A643T probably damaging Het
Ect2 C A 3: 27,144,963 E194* probably null Het
Epb41l2 A G 10: 25,441,815 I77V possibly damaging Het
Fat3 A T 9: 16,006,528 probably null Het
Fbn2 T G 18: 58,048,920 D1803A probably damaging Het
Fbxo10 T C 4: 45,040,631 E858G probably benign Het
Fbxo24 C T 5: 137,619,650 R284Q probably benign Het
Fsip2 T A 2: 82,963,313 I425N possibly damaging Het
Fut9 A C 4: 25,620,090 Y241* probably null Het
Galr2 A G 11: 116,283,026 S161G possibly damaging Het
Gcc2 T A 10: 58,258,243 L14I probably damaging Het
Gm11127 A T 17: 36,056,785 D220E probably benign Het
Hdac11 G A 6: 91,173,214 V332I probably benign Het
Hdac7 T C 15: 97,802,072 probably null Het
Kif16b C T 2: 142,857,381 G93D probably damaging Het
Krtap11-1 C A 16: 89,570,768 C121F possibly damaging Het
Lacc1 T C 14: 77,035,077 Q93R probably damaging Het
Lama1 T C 17: 67,773,727 F1250S probably benign Het
Lmbrd2 A G 15: 9,172,115 E332G probably benign Het
Lrp2 C A 2: 69,459,548 C3649F probably damaging Het
Map1a T C 2: 121,304,376 V1653A probably benign Het
Mrpl1 T C 5: 96,231,794 probably null Het
Myo1b A G 1: 51,778,373 S577P probably damaging Het
Nedd4 T A 9: 72,743,638 probably null Het
Negr1 T A 3: 157,069,286 V213E probably damaging Het
Nlk T G 11: 78,590,966 Q223P probably benign Het
Ntn5 A G 7: 45,691,424 H162R probably damaging Het
Nupl2 T C 5: 24,167,402 S63P probably damaging Het
Obscn C A 11: 59,076,547 D477Y probably damaging Het
Olfr101 A T 17: 37,300,338 I28N possibly damaging Het
Olfr1037 T C 2: 86,084,881 S299G probably benign Het
Olfr1434 T C 19: 12,283,836 S263P probably damaging Het
Pabpn1 A G 14: 54,897,160 T280A probably damaging Het
Per3 A T 4: 151,042,737 V109E possibly damaging Het
Pira2 A C 7: 3,841,577 V485G probably benign Het
Pknox2 A G 9: 36,936,322 L133P probably damaging Het
Pros1 A C 16: 62,900,667 N195T probably damaging Het
Rffl T C 11: 82,806,151 K289E probably damaging Het
Ripk1 T A 13: 34,030,101 Y475* probably null Het
Ryr2 A G 13: 11,714,511 probably null Het
Sgk1 T A 10: 21,996,249 N241K probably damaging Het
Skint1 T A 4: 112,019,319 S146T probably benign Het
Sox30 G T 11: 45,981,073 D252Y probably damaging Het
Syngap1 A G 17: 26,963,038 Y1002C probably damaging Het
Tiam2 A G 17: 3,414,809 D271G possibly damaging Het
Ticam1 T C 17: 56,271,178 T306A probably benign Het
Tmem252 A G 19: 24,674,268 E67G probably benign Het
Tnxb T G 17: 34,685,707 F1149V probably damaging Het
Ubr4 A G 4: 139,421,078 probably null Het
Unc50 A G 1: 37,437,209 D150G probably benign Het
Ywhag A C 5: 135,911,629 L37R probably damaging Het
Zfp296 T C 7: 19,577,937 L123P probably benign Het
Zfp418 G T 7: 7,182,200 Q387H possibly damaging Het
Zfp882 T C 8: 71,913,155 F53L probably damaging Het
Other mutations in Dido1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dido1 APN 2 180683989 missense probably benign
IGL00834:Dido1 APN 2 180689526 missense possibly damaging 0.87
IGL01317:Dido1 APN 2 180671757 missense probably benign 0.17
IGL01588:Dido1 APN 2 180688875 missense probably benign 0.00
IGL01834:Dido1 APN 2 180684031 splice site probably benign
IGL02102:Dido1 APN 2 180662247 missense possibly damaging 0.58
IGL02556:Dido1 APN 2 180689335 missense possibly damaging 0.69
IGL02756:Dido1 APN 2 180661923 missense probably benign 0.00
IGL02826:Dido1 APN 2 180683958 missense probably benign
IGL02970:Dido1 APN 2 180689415 missense probably damaging 0.99
IGL03110:Dido1 APN 2 180689342 missense probably damaging 1.00
IGL03116:Dido1 APN 2 180670979 missense probably damaging 1.00
3370:Dido1 UTSW 2 180671542 missense probably benign
A4554:Dido1 UTSW 2 180675371 missense probably damaging 1.00
H8441:Dido1 UTSW 2 180689014 missense probably benign 0.12
R0044:Dido1 UTSW 2 180661819 missense probably damaging 1.00
R0044:Dido1 UTSW 2 180661819 missense probably damaging 1.00
R0054:Dido1 UTSW 2 180661474 missense probably benign 0.00
R0054:Dido1 UTSW 2 180661474 missense probably benign 0.00
R0127:Dido1 UTSW 2 180671824 missense probably benign 0.01
R0620:Dido1 UTSW 2 180659851 missense probably benign 0.26
R0734:Dido1 UTSW 2 180660042 missense probably benign 0.01
R1390:Dido1 UTSW 2 180685124 missense possibly damaging 0.70
R1445:Dido1 UTSW 2 180671470 missense possibly damaging 0.62
R1466:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R1466:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R1472:Dido1 UTSW 2 180660720 missense probably benign 0.02
R1538:Dido1 UTSW 2 180684970 missense possibly damaging 0.49
R1584:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R2020:Dido1 UTSW 2 180659585 missense unknown
R2025:Dido1 UTSW 2 180689181 nonsense probably null
R2026:Dido1 UTSW 2 180689181 nonsense probably null
R2027:Dido1 UTSW 2 180689181 nonsense probably null
R2089:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2091:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2091:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2495:Dido1 UTSW 2 180689388 missense probably benign 0.00
R2931:Dido1 UTSW 2 180661653 missense probably damaging 1.00
R3418:Dido1 UTSW 2 180660935 missense possibly damaging 0.84
R3735:Dido1 UTSW 2 180684036 splice site probably benign
R4523:Dido1 UTSW 2 180672292 missense probably damaging 1.00
R4674:Dido1 UTSW 2 180687559 missense probably damaging 0.97
R4729:Dido1 UTSW 2 180687650 missense probably benign 0.00
R4762:Dido1 UTSW 2 180689575 missense probably damaging 1.00
R4786:Dido1 UTSW 2 180670871 missense possibly damaging 0.85
R4817:Dido1 UTSW 2 180661416 missense probably benign 0.02
R4892:Dido1 UTSW 2 180675029 nonsense probably null
R4979:Dido1 UTSW 2 180660813 missense probably damaging 0.98
R5510:Dido1 UTSW 2 180685173 missense probably benign 0.00
R5586:Dido1 UTSW 2 180659652 nonsense probably null
R5672:Dido1 UTSW 2 180671903 missense probably damaging 0.99
R5863:Dido1 UTSW 2 180661773 missense probably benign 0.02
R5943:Dido1 UTSW 2 180661882 missense probably benign 0.00
R6123:Dido1 UTSW 2 180683967 missense probably benign 0.07
R6214:Dido1 UTSW 2 180662152 missense probably damaging 1.00
R6215:Dido1 UTSW 2 180662152 missense probably damaging 1.00
R6248:Dido1 UTSW 2 180660255 missense probably damaging 1.00
R6285:Dido1 UTSW 2 180661147 missense probably benign 0.00
R6349:Dido1 UTSW 2 180660701 missense probably benign 0.03
R6437:Dido1 UTSW 2 180675013 missense probably damaging 1.00
R6477:Dido1 UTSW 2 180660481 missense probably benign 0.00
R6836:Dido1 UTSW 2 180662307 missense probably benign 0.16
R7055:Dido1 UTSW 2 180661209 missense probably benign 0.09
R7289:Dido1 UTSW 2 180659631 missense unknown
R7304:Dido1 UTSW 2 180687493 missense probably damaging 1.00
R7343:Dido1 UTSW 2 180675121 missense possibly damaging 0.49
R7363:Dido1 UTSW 2 180662517 nonsense probably null
R7429:Dido1 UTSW 2 180689526 missense possibly damaging 0.87
R7594:Dido1 UTSW 2 180675112 missense probably benign
R7629:Dido1 UTSW 2 180661473 missense probably benign
R7899:Dido1 UTSW 2 180671597 missense possibly damaging 0.82
R7946:Dido1 UTSW 2 180661708 missense possibly damaging 0.81
R7951:Dido1 UTSW 2 180670881 missense probably benign 0.01
R8033:Dido1 UTSW 2 180674842 missense probably damaging 1.00
R8069:Dido1 UTSW 2 180660912 missense probably benign
R8331:Dido1 UTSW 2 180660449 missense probably benign 0.00
R8479:Dido1 UTSW 2 180673229 critical splice donor site probably null
V1024:Dido1 UTSW 2 180689014 missense probably benign 0.12
X0011:Dido1 UTSW 2 180660834 missense probably benign 0.00
X0019:Dido1 UTSW 2 180671572 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TTCTGGTAAGTCTAATCACCAGC -3'
(R):5'- GTGTTTCCCTGAGTCTCCAG -3'

Sequencing Primer
(F):5'- AGCTTCCCTGGTCAGTCTAAAGG -3'
(R):5'- CCTGAGTCTCCAGGCGATAG -3'
Posted On2017-03-31