Mutagenetix > Incidental Mutation

Incidental Mutation 'R5974:Fut9'

471599

Institutional Source

Beutler Lab

Gene Symbol

Fut9

Ensembl Gene

ENSMUSG00000055373

Gene Name

fucosyltransferase 9

Synonyms

mFuc-TIX, mFUT9

MMRRC Submission

044157-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5974 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25609332-25800244 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to C at 25620090 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 241 (Y241*)

Ref Sequence

ENSEMBL: ENSMUSP00000103834 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084770] [ENSMUST00000108199]

AlphaFold

O88819

Predicted Effect

probably null
Transcript: ENSMUST00000084770
AA Change: Y241*

SMART Domains

Protein: ENSMUSP00000081826
Gene: ENSMUSG00000055373
AA Change: Y241*

Domain	Start	End	E-Value	Type
Pfam:Glyco_transf_10	6	358	2.9e-140	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000108199
AA Change: Y241*

SMART Domains

Protein: ENSMUSP00000103834
Gene: ENSMUSG00000055373
AA Change: Y241*

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:Glyco_tran_10_N	61	169	1.4e-43	PFAM
Pfam:Glyco_transf_10	185	357	4.8e-69	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It is localized to the golgi, and catalyzes the last step in the biosynthesis of Lewis X (LeX) antigen, the addition of a fucose to precursor polysaccharides. This protein is one of the few fucosyltransferases that synthesizes the LeX oligosaccharide (CD15) expressed in the organ buds progressing in mesenchyma during embryogenesis. It is also responsible for the expression of CD15 in mature granulocytes. A common haplotype of this gene has also been associated with susceptibility to placental malaria infection. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased number of neuronal stem cells with increased self-renewal capacity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc4	T	C	5: 52,845,400	L261P	probably damaging	Het
Aqp6	A	G	15: 99,601,436	Y10C	probably benign	Het
Ccnb1ip1	A	T	14: 50,792,205	N133K	probably benign	Het
Clip4	A	T	17: 71,831,247	H433L	probably damaging	Het
Cntnap5c	T	A	17: 57,876,485	M62K	probably benign	Het
Col12a1	A	G	9: 79,682,127	S1049P	probably damaging	Het
Col15a1	C	T	4: 47,258,683	T358I	probably benign	Het
Coro7	A	T	16: 4,631,889	D645E	possibly damaging	Het
Ctnnal1	C	A	4: 56,817,067	W585L	probably damaging	Het
Ctnnd1	C	A	2: 84,620,915	E114*	probably null	Het
Daam2	T	A	17: 49,464,473	S882C	probably damaging	Het
Des	T	A	1: 75,362,984	S329T	probably benign	Het
Dido1	T	C	2: 180,671,497	D994G	probably benign	Het
Dock3	A	G	9: 106,994,062	V547A	probably damaging	Het
Ebf4	G	A	2: 130,365,564	A643T	probably damaging	Het
Ect2	C	A	3: 27,144,963	E194*	probably null	Het
Epb41l2	A	G	10: 25,441,815	I77V	possibly damaging	Het
Fat3	A	T	9: 16,006,528		probably null	Het
Fbn2	T	G	18: 58,048,920	D1803A	probably damaging	Het
Fbxo10	T	C	4: 45,040,631	E858G	probably benign	Het
Fbxo24	C	T	5: 137,619,650	R284Q	probably benign	Het
Fsip2	T	A	2: 82,963,313	I425N	possibly damaging	Het
Galr2	A	G	11: 116,283,026	S161G	possibly damaging	Het
Gcc2	T	A	10: 58,258,243	L14I	probably damaging	Het
Gm11127	A	T	17: 36,056,785	D220E	probably benign	Het
Hdac11	G	A	6: 91,173,214	V332I	probably benign	Het
Hdac7	T	C	15: 97,802,072		probably null	Het
Kif16b	C	T	2: 142,857,381	G93D	probably damaging	Het
Krtap11-1	C	A	16: 89,570,768	C121F	possibly damaging	Het
Lacc1	T	C	14: 77,035,077	Q93R	probably damaging	Het
Lama1	T	C	17: 67,773,727	F1250S	probably benign	Het
Lmbrd2	A	G	15: 9,172,115	E332G	probably benign	Het
Lrp2	C	A	2: 69,459,548	C3649F	probably damaging	Het
Map1a	T	C	2: 121,304,376	V1653A	probably benign	Het
Mrpl1	T	C	5: 96,231,794		probably null	Het
Myo1b	A	G	1: 51,778,373	S577P	probably damaging	Het
Nedd4	T	A	9: 72,743,638		probably null	Het
Negr1	T	A	3: 157,069,286	V213E	probably damaging	Het
Nlk	T	G	11: 78,590,966	Q223P	probably benign	Het
Ntn5	A	G	7: 45,691,424	H162R	probably damaging	Het
Nupl2	T	C	5: 24,167,402	S63P	probably damaging	Het
Obscn	C	A	11: 59,076,547	D477Y	probably damaging	Het
Olfr101	A	T	17: 37,300,338	I28N	possibly damaging	Het
Olfr1037	T	C	2: 86,084,881	S299G	probably benign	Het
Olfr1434	T	C	19: 12,283,836	S263P	probably damaging	Het
Pabpn1	A	G	14: 54,897,160	T280A	probably damaging	Het
Per3	A	T	4: 151,042,737	V109E	possibly damaging	Het
Pira2	A	C	7: 3,841,577	V485G	probably benign	Het
Pknox2	A	G	9: 36,936,322	L133P	probably damaging	Het
Pros1	A	C	16: 62,900,667	N195T	probably damaging	Het
Rffl	T	C	11: 82,806,151	K289E	probably damaging	Het
Ripk1	T	A	13: 34,030,101	Y475*	probably null	Het
Ryr2	A	G	13: 11,714,511		probably null	Het
Sgk1	T	A	10: 21,996,249	N241K	probably damaging	Het
Skint1	T	A	4: 112,019,319	S146T	probably benign	Het
Sox30	G	T	11: 45,981,073	D252Y	probably damaging	Het
Syngap1	A	G	17: 26,963,038	Y1002C	probably damaging	Het
Tiam2	A	G	17: 3,414,809	D271G	possibly damaging	Het
Ticam1	T	C	17: 56,271,178	T306A	probably benign	Het
Tmem252	A	G	19: 24,674,268	E67G	probably benign	Het
Tnxb	T	G	17: 34,685,707	F1149V	probably damaging	Het
Ubr4	A	G	4: 139,421,078		probably null	Het
Unc50	A	G	1: 37,437,209	D150G	probably benign	Het
Ywhag	A	C	5: 135,911,629	L37R	probably damaging	Het
Zfp296	T	C	7: 19,577,937	L123P	probably benign	Het
Zfp418	G	T	7: 7,182,200	Q387H	possibly damaging	Het
Zfp882	T	C	8: 71,913,155	F53L	probably damaging	Het

Other mutations in Fut9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00919:Fut9	APN	4	25620316	missense	possibly damaging	0.71
IGL01134:Fut9	APN	4	25620446	missense	probably benign	0.13
IGL01330:Fut9	APN	4	25619791	missense	possibly damaging	0.95
IGL01732:Fut9	APN	4	25619867	missense	possibly damaging	0.58
IGL02824:Fut9	APN	4	25620037	missense	probably damaging	1.00
ANU74:Fut9	UTSW	4	25620802	missense	probably benign	0.25
R0280:Fut9	UTSW	4	25619852	missense	probably benign	0.00
R0408:Fut9	UTSW	4	25620319	missense	possibly damaging	0.69
R0594:Fut9	UTSW	4	25620526	missense	possibly damaging	0.94
R0609:Fut9	UTSW	4	25620811	start codon destroyed	probably null	0.98
R0709:Fut9	UTSW	4	25620359	missense	probably damaging	1.00
R1567:Fut9	UTSW	4	25620344	missense	probably damaging	0.99
R1719:Fut9	UTSW	4	25619744	missense	possibly damaging	0.62
R1856:Fut9	UTSW	4	25620352	missense	probably damaging	1.00
R2036:Fut9	UTSW	4	25620322	missense	probably damaging	1.00
R2165:Fut9	UTSW	4	25619733	makesense	probably null
R2165:Fut9	UTSW	4	25619734	makesense	probably null
R2332:Fut9	UTSW	4	25619823	nonsense	probably null
R4539:Fut9	UTSW	4	25619793	missense	probably damaging	1.00
R4722:Fut9	UTSW	4	25799734	utr 5 prime	probably benign
R4766:Fut9	UTSW	4	25799191	intron	probably benign
R4937:Fut9	UTSW	4	25799591	splice site	probably benign
R5025:Fut9	UTSW	4	25620502	missense	probably damaging	1.00
R5032:Fut9	UTSW	4	25799245	intron	probably benign
R5158:Fut9	UTSW	4	25620731	missense	probably benign	0.01
R5601:Fut9	UTSW	4	25620299	missense	probably benign	0.00
R6315:Fut9	UTSW	4	25619774	missense	probably damaging	1.00
R6385:Fut9	UTSW	4	25620328	missense	probably damaging	1.00
R6652:Fut9	UTSW	4	25620619	missense	probably benign	0.44
R6809:Fut9	UTSW	4	25620647	missense	probably benign
R6825:Fut9	UTSW	4	25619925	missense	probably benign
R7145:Fut9	UTSW	4	25620507	missense	probably damaging	0.96
R7573:Fut9	UTSW	4	25620691	missense	probably benign	0.04
R8933:Fut9	UTSW	4	25619861	missense	probably damaging	1.00
R9715:Fut9	UTSW	4	25620679	missense	probably benign	0.00
X0057:Fut9	UTSW	4	25799686	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTGATTCCCAAAACCGTGG -3'
(R):5'- TGTTTGAAGTGCCAAGCAAG -3'

Sequencing Primer
(F):5'- CCGTGGTAGGTTTACAGTAAAATCC -3'
(R):5'- CAAGGAGAAGTTGGTGTGCTG -3'

Posted On

2017-03-31