Incidental Mutation 'R5974:Ctnnal1'
ID 471602
Institutional Source Beutler Lab
Gene Symbol Ctnnal1
Ensembl Gene ENSMUSG00000038816
Gene Name catenin (cadherin associated protein), alpha-like 1
Synonyms Catnal1, ACRP
MMRRC Submission 044157-MU
Accession Numbers

Genbank: NM_018761.3; Ensembl: ENSMUST00000045142, ENSMUST00000107612

Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock # R5974 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 56810935-56865188 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 56817067 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Leucine at position 585 (W585L)
Ref Sequence ENSEMBL: ENSMUSP00000036487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045142]
AlphaFold O88327
Predicted Effect probably damaging
Transcript: ENSMUST00000045142
AA Change: W585L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036487
Gene: ENSMUSG00000038816
AA Change: W585L

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:Vinculin 30 309 7e-39 PFAM
Pfam:Vinculin 302 526 1.7e-12 PFAM
Pfam:Vinculin 531 683 5.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134915
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted disruption of this gene are viable and fertile and exhibit no overt phenotypes or defects in hematopoiesis and hematopoietic stem cell function. [provided by MGI curators]
Allele List at MGI

All alleles(111) : Targeted, other(2) Gene trapped(109)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc4 T C 5: 52,845,400 L261P probably damaging Het
Aqp6 A G 15: 99,601,436 Y10C probably benign Het
Ccnb1ip1 A T 14: 50,792,205 N133K probably benign Het
Clip4 A T 17: 71,831,247 H433L probably damaging Het
Cntnap5c T A 17: 57,876,485 M62K probably benign Het
Col12a1 A G 9: 79,682,127 S1049P probably damaging Het
Col15a1 C T 4: 47,258,683 T358I probably benign Het
Coro7 A T 16: 4,631,889 D645E possibly damaging Het
Ctnnd1 C A 2: 84,620,915 E114* probably null Het
Daam2 T A 17: 49,464,473 S882C probably damaging Het
Des T A 1: 75,362,984 S329T probably benign Het
Dido1 T C 2: 180,671,497 D994G probably benign Het
Dock3 A G 9: 106,994,062 V547A probably damaging Het
Ebf4 G A 2: 130,365,564 A643T probably damaging Het
Ect2 C A 3: 27,144,963 E194* probably null Het
Epb41l2 A G 10: 25,441,815 I77V possibly damaging Het
Fat3 A T 9: 16,006,528 probably null Het
Fbn2 T G 18: 58,048,920 D1803A probably damaging Het
Fbxo10 T C 4: 45,040,631 E858G probably benign Het
Fbxo24 C T 5: 137,619,650 R284Q probably benign Het
Fsip2 T A 2: 82,963,313 I425N possibly damaging Het
Fut9 A C 4: 25,620,090 Y241* probably null Het
Galr2 A G 11: 116,283,026 S161G possibly damaging Het
Gcc2 T A 10: 58,258,243 L14I probably damaging Het
Gm11127 A T 17: 36,056,785 D220E probably benign Het
Hdac11 G A 6: 91,173,214 V332I probably benign Het
Hdac7 T C 15: 97,802,072 probably null Het
Kif16b C T 2: 142,857,381 G93D probably damaging Het
Krtap11-1 C A 16: 89,570,768 C121F possibly damaging Het
Lacc1 T C 14: 77,035,077 Q93R probably damaging Het
Lama1 T C 17: 67,773,727 F1250S probably benign Het
Lmbrd2 A G 15: 9,172,115 E332G probably benign Het
Lrp2 C A 2: 69,459,548 C3649F probably damaging Het
Map1a T C 2: 121,304,376 V1653A probably benign Het
Mrpl1 T C 5: 96,231,794 probably null Het
Myo1b A G 1: 51,778,373 S577P probably damaging Het
Nedd4 T A 9: 72,743,638 probably null Het
Negr1 T A 3: 157,069,286 V213E probably damaging Het
Nlk T G 11: 78,590,966 Q223P probably benign Het
Ntn5 A G 7: 45,691,424 H162R probably damaging Het
Nupl2 T C 5: 24,167,402 S63P probably damaging Het
Obscn C A 11: 59,076,547 D477Y probably damaging Het
Olfr101 A T 17: 37,300,338 I28N possibly damaging Het
Olfr1037 T C 2: 86,084,881 S299G probably benign Het
Olfr1434 T C 19: 12,283,836 S263P probably damaging Het
Pabpn1 A G 14: 54,897,160 T280A probably damaging Het
Per3 A T 4: 151,042,737 V109E possibly damaging Het
Pira2 A C 7: 3,841,577 V485G probably benign Het
Pknox2 A G 9: 36,936,322 L133P probably damaging Het
Pros1 A C 16: 62,900,667 N195T probably damaging Het
Rffl T C 11: 82,806,151 K289E probably damaging Het
Ripk1 T A 13: 34,030,101 Y475* probably null Het
Ryr2 A G 13: 11,714,511 probably null Het
Sgk1 T A 10: 21,996,249 N241K probably damaging Het
Skint1 T A 4: 112,019,319 S146T probably benign Het
Sox30 G T 11: 45,981,073 D252Y probably damaging Het
Syngap1 A G 17: 26,963,038 Y1002C probably damaging Het
Tiam2 A G 17: 3,414,809 D271G possibly damaging Het
Ticam1 T C 17: 56,271,178 T306A probably benign Het
Tmem252 A G 19: 24,674,268 E67G probably benign Het
Tnxb T G 17: 34,685,707 F1149V probably damaging Het
Ubr4 A G 4: 139,421,078 probably null Het
Unc50 A G 1: 37,437,209 D150G probably benign Het
Ywhag A C 5: 135,911,629 L37R probably damaging Het
Zfp296 T C 7: 19,577,937 L123P probably benign Het
Zfp418 G T 7: 7,182,200 Q387H possibly damaging Het
Zfp882 T C 8: 71,913,155 F53L probably damaging Het
Other mutations in Ctnnal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Ctnnal1 APN 4 56829544 missense possibly damaging 0.90
IGL01404:Ctnnal1 APN 4 56829590 missense probably damaging 1.00
IGL01523:Ctnnal1 APN 4 56835243 missense probably damaging 1.00
IGL02413:Ctnnal1 APN 4 56835306 missense probably benign 0.19
IGL02618:Ctnnal1 APN 4 56817060 missense probably benign 0.07
IGL03109:Ctnnal1 APN 4 56839045 missense probably damaging 1.00
IGL03159:Ctnnal1 APN 4 56844599 missense probably benign 0.00
IGL03208:Ctnnal1 APN 4 56813833 missense probably benign 0.00
IGL03250:Ctnnal1 APN 4 56812356 missense probably benign 0.00
NA:Ctnnal1 UTSW 4 56817044 missense probably benign 0.02
R0217:Ctnnal1 UTSW 4 56813230 missense probably benign 0.43
R0391:Ctnnal1 UTSW 4 56847921 missense probably damaging 1.00
R0513:Ctnnal1 UTSW 4 56835348 missense probably benign 0.01
R0582:Ctnnal1 UTSW 4 56813228 missense probably damaging 1.00
R1434:Ctnnal1 UTSW 4 56847971 missense probably damaging 0.96
R1638:Ctnnal1 UTSW 4 56813856 missense probably benign 0.06
R1760:Ctnnal1 UTSW 4 56838988 missense probably damaging 1.00
R1871:Ctnnal1 UTSW 4 56812534 missense probably benign 0.06
R1954:Ctnnal1 UTSW 4 56817242 splice site probably benign
R2050:Ctnnal1 UTSW 4 56835350 missense probably benign 0.38
R2104:Ctnnal1 UTSW 4 56812329 makesense probably null
R3104:Ctnnal1 UTSW 4 56813246 missense probably benign 0.11
R3106:Ctnnal1 UTSW 4 56813246 missense probably benign 0.11
R3918:Ctnnal1 UTSW 4 56865000 missense possibly damaging 0.89
R4705:Ctnnal1 UTSW 4 56812579 missense probably benign 0.09
R4757:Ctnnal1 UTSW 4 56847980 missense probably damaging 1.00
R4780:Ctnnal1 UTSW 4 56847857 missense probably damaging 1.00
R4988:Ctnnal1 UTSW 4 56847854 nonsense probably null
R5771:Ctnnal1 UTSW 4 56826328 missense probably benign 0.00
R6061:Ctnnal1 UTSW 4 56812349 missense probably benign
R6129:Ctnnal1 UTSW 4 56829573 missense possibly damaging 0.93
R6389:Ctnnal1 UTSW 4 56813849 missense probably benign 0.00
R7259:Ctnnal1 UTSW 4 56817299 critical splice acceptor site probably null
R7372:Ctnnal1 UTSW 4 56826285 missense possibly damaging 0.75
R7454:Ctnnal1 UTSW 4 56844544 missense probably damaging 1.00
R7520:Ctnnal1 UTSW 4 56837838 missense probably damaging 1.00
R7547:Ctnnal1 UTSW 4 56817032 missense probably damaging 0.99
R7671:Ctnnal1 UTSW 4 56837848 missense probably damaging 1.00
R8097:Ctnnal1 UTSW 4 56847845 missense probably damaging 1.00
R8677:Ctnnal1 UTSW 4 56813272 missense probably benign 0.00
R8697:Ctnnal1 UTSW 4 56838986 missense probably damaging 0.98
R8809:Ctnnal1 UTSW 4 56835374 missense possibly damaging 0.68
R9649:Ctnnal1 UTSW 4 56865036 missense possibly damaging 0.95
R9739:Ctnnal1 UTSW 4 56816200 missense probably damaging 1.00
R9790:Ctnnal1 UTSW 4 56844584 missense possibly damaging 0.71
R9791:Ctnnal1 UTSW 4 56844584 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AGAGTTTGAGCTAGCCTCTGC -3'
(R):5'- TAAGCTCTCTGGGTGTGTAAC -3'

Sequencing Primer
(F):5'- AAGGTTGCTGAAAGTTCTAGGCC -3'
(R):5'- GGTGTGTAACAGTCTTGTATCAATAG -3'
Posted On 2017-03-31