Incidental Mutation 'R5974:Fbxo24'
ID471612
Institutional Source Beutler Lab
Gene Symbol Fbxo24
Ensembl Gene ENSMUSG00000089984
Gene NameF-box protein 24
Synonyms4933422D21Rik, Fbx24
MMRRC Submission 044157-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5974 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location137612503-137629002 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 137619650 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 284 (R284Q)
Ref Sequence ENSEMBL: ENSMUSP00000031732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031732] [ENSMUST00000111002] [ENSMUST00000136028]
Predicted Effect probably benign
Transcript: ENSMUST00000031732
AA Change: R284Q

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000031732
Gene: ENSMUSG00000089984
AA Change: R284Q

DomainStartEndE-ValueType
FBOX 29 69 1.48e-7 SMART
Pfam:RCC1 386 432 2.2e-10 PFAM
low complexity region 442 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111002
AA Change: R167Q

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106630
Gene: ENSMUSG00000089984
AA Change: R167Q

DomainStartEndE-ValueType
Pfam:RCC1 247 293 4.2e-11 PFAM
low complexity region 303 316 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117679
Predicted Effect probably benign
Transcript: ENSMUST00000136028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196660
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc4 T C 5: 52,845,400 L261P probably damaging Het
Aqp6 A G 15: 99,601,436 Y10C probably benign Het
Ccnb1ip1 A T 14: 50,792,205 N133K probably benign Het
Clip4 A T 17: 71,831,247 H433L probably damaging Het
Cntnap5c T A 17: 57,876,485 M62K probably benign Het
Col12a1 A G 9: 79,682,127 S1049P probably damaging Het
Col15a1 C T 4: 47,258,683 T358I probably benign Het
Coro7 A T 16: 4,631,889 D645E possibly damaging Het
Ctnnal1 C A 4: 56,817,067 W585L probably damaging Het
Ctnnd1 C A 2: 84,620,915 E114* probably null Het
Daam2 T A 17: 49,464,473 S882C probably damaging Het
Des T A 1: 75,362,984 S329T probably benign Het
Dido1 T C 2: 180,671,497 D994G probably benign Het
Dock3 A G 9: 106,994,062 V547A probably damaging Het
Ebf4 G A 2: 130,365,564 A643T probably damaging Het
Ect2 C A 3: 27,144,963 E194* probably null Het
Epb41l2 A G 10: 25,441,815 I77V possibly damaging Het
Fat3 A T 9: 16,006,528 probably null Het
Fbn2 T G 18: 58,048,920 D1803A probably damaging Het
Fbxo10 T C 4: 45,040,631 E858G probably benign Het
Fsip2 T A 2: 82,963,313 I425N possibly damaging Het
Fut9 A C 4: 25,620,090 Y241* probably null Het
Galr2 A G 11: 116,283,026 S161G possibly damaging Het
Gcc2 T A 10: 58,258,243 L14I probably damaging Het
Gm11127 A T 17: 36,056,785 D220E probably benign Het
Hdac11 G A 6: 91,173,214 V332I probably benign Het
Hdac7 T C 15: 97,802,072 probably null Het
Kif16b C T 2: 142,857,381 G93D probably damaging Het
Krtap11-1 C A 16: 89,570,768 C121F possibly damaging Het
Lacc1 T C 14: 77,035,077 Q93R probably damaging Het
Lama1 T C 17: 67,773,727 F1250S probably benign Het
Lmbrd2 A G 15: 9,172,115 E332G probably benign Het
Lrp2 C A 2: 69,459,548 C3649F probably damaging Het
Map1a T C 2: 121,304,376 V1653A probably benign Het
Mrpl1 T C 5: 96,231,794 probably null Het
Myo1b A G 1: 51,778,373 S577P probably damaging Het
Nedd4 T A 9: 72,743,638 probably null Het
Negr1 T A 3: 157,069,286 V213E probably damaging Het
Nlk T G 11: 78,590,966 Q223P probably benign Het
Ntn5 A G 7: 45,691,424 H162R probably damaging Het
Nupl2 T C 5: 24,167,402 S63P probably damaging Het
Obscn C A 11: 59,076,547 D477Y probably damaging Het
Olfr101 A T 17: 37,300,338 I28N possibly damaging Het
Olfr1037 T C 2: 86,084,881 S299G probably benign Het
Olfr1434 T C 19: 12,283,836 S263P probably damaging Het
Pabpn1 A G 14: 54,897,160 T280A probably damaging Het
Per3 A T 4: 151,042,737 V109E possibly damaging Het
Pira2 A C 7: 3,841,577 V485G probably benign Het
Pknox2 A G 9: 36,936,322 L133P probably damaging Het
Pros1 A C 16: 62,900,667 N195T probably damaging Het
Rffl T C 11: 82,806,151 K289E probably damaging Het
Ripk1 T A 13: 34,030,101 Y475* probably null Het
Ryr2 A G 13: 11,714,511 probably null Het
Sgk1 T A 10: 21,996,249 N241K probably damaging Het
Skint1 T A 4: 112,019,319 S146T probably benign Het
Sox30 G T 11: 45,981,073 D252Y probably damaging Het
Syngap1 A G 17: 26,963,038 Y1002C probably damaging Het
Tiam2 A G 17: 3,414,809 D271G possibly damaging Het
Ticam1 T C 17: 56,271,178 T306A probably benign Het
Tmem252 A G 19: 24,674,268 E67G probably benign Het
Tnxb T G 17: 34,685,707 F1149V probably damaging Het
Ubr4 A G 4: 139,421,078 probably null Het
Unc50 A G 1: 37,437,209 D150G probably benign Het
Ywhag A C 5: 135,911,629 L37R probably damaging Het
Zfp296 T C 7: 19,577,937 L123P probably benign Het
Zfp418 G T 7: 7,182,200 Q387H possibly damaging Het
Zfp882 T C 8: 71,913,155 F53L probably damaging Het
Other mutations in Fbxo24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Fbxo24 APN 5 137624301 missense probably damaging 1.00
IGL01872:Fbxo24 APN 5 137613725 missense probably damaging 1.00
IGL02066:Fbxo24 APN 5 137612870 missense probably damaging 1.00
IGL02078:Fbxo24 APN 5 137624349 missense probably damaging 1.00
IGL02330:Fbxo24 APN 5 137621317 missense probably damaging 1.00
PIT4131001:Fbxo24 UTSW 5 137621902 missense probably damaging 1.00
R0012:Fbxo24 UTSW 5 137621994 missense probably damaging 1.00
R0012:Fbxo24 UTSW 5 137621994 missense probably damaging 1.00
R0243:Fbxo24 UTSW 5 137624557 missense probably damaging 0.98
R0990:Fbxo24 UTSW 5 137618439 missense probably damaging 0.99
R1331:Fbxo24 UTSW 5 137619629 missense probably damaging 1.00
R2139:Fbxo24 UTSW 5 137613065 missense probably damaging 0.99
R5483:Fbxo24 UTSW 5 137618740 missense probably damaging 0.99
R5487:Fbxo24 UTSW 5 137618832 missense possibly damaging 0.88
R5954:Fbxo24 UTSW 5 137619681 missense probably damaging 1.00
R6250:Fbxo24 UTSW 5 137621281 missense probably damaging 1.00
R6600:Fbxo24 UTSW 5 137612873 missense probably damaging 1.00
R7345:Fbxo24 UTSW 5 137621261 missense probably damaging 0.99
R7412:Fbxo24 UTSW 5 137619623 missense possibly damaging 0.48
X0064:Fbxo24 UTSW 5 137621236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTACAAGTTTACAGGGACCC -3'
(R):5'- CAGGCAGCGTTTCTGTTGAG -3'

Sequencing Primer
(F):5'- TTTACAGGGACCCGGCCC -3'
(R):5'- CAGCGTTTCTGTTGAGTGTCCC -3'
Posted On2017-03-31