Incidental Mutation 'R5974:Col12a1'
ID471624
Institutional Source Beutler Lab
Gene Symbol Col12a1
Ensembl Gene ENSMUSG00000032332
Gene Namecollagen, type XII, alpha 1
Synonyms
MMRRC Submission 044157-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R5974 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location79598991-79718831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79682127 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1049 (S1049P)
Ref Sequence ENSEMBL: ENSMUSP00000112604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071750] [ENSMUST00000121227]
Predicted Effect probably damaging
Transcript: ENSMUST00000071750
AA Change: S1049P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071662
Gene: ENSMUSG00000032332
AA Change: S1049P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 25 103 2.29e-10 SMART
low complexity region 114 129 N/A INTRINSIC
VWA 138 317 4e-63 SMART
FN3 334 413 1.47e-8 SMART
VWA 438 617 2.41e-57 SMART
FN3 632 710 1.62e-10 SMART
FN3 723 801 2.91e-12 SMART
FN3 814 892 6.05e-10 SMART
FN3 905 984 2.74e-8 SMART
FN3 995 1074 1.24e-6 SMART
FN3 1087 1166 5.78e-7 SMART
VWA 1197 1376 2.02e-59 SMART
FN3 1385 1463 1.13e-9 SMART
FN3 1474 1554 1.07e-10 SMART
FN3 1566 1643 3.73e-10 SMART
FN3 1655 1734 2.94e-8 SMART
FN3 1755 1834 1.54e-11 SMART
FN3 1846 1924 1.45e-7 SMART
FN3 1936 2015 1.47e-8 SMART
FN3 2027 2106 1.21e-9 SMART
FN3 2118 2195 2.14e-10 SMART
FN3 2206 2285 3.85e-3 SMART
low complexity region 2292 2314 N/A INTRINSIC
VWA 2323 2503 2.61e-53 SMART
TSPN 2522 2714 1.13e-76 SMART
Pfam:Collagen 2747 2804 1.7e-8 PFAM
Pfam:Collagen 2802 2855 6.5e-9 PFAM
Pfam:Collagen 2844 2904 1.1e-9 PFAM
Pfam:Collagen 2939 2994 4.6e-8 PFAM
low complexity region 3011 3044 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121227
AA Change: S1049P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112604
Gene: ENSMUSG00000032332
AA Change: S1049P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 25 103 2.29e-10 SMART
low complexity region 114 129 N/A INTRINSIC
VWA 138 317 4e-63 SMART
FN3 334 413 1.47e-8 SMART
VWA 438 617 2.41e-57 SMART
FN3 632 710 1.62e-10 SMART
FN3 723 801 2.91e-12 SMART
FN3 814 892 6.05e-10 SMART
FN3 905 984 2.74e-8 SMART
FN3 995 1074 1.24e-6 SMART
FN3 1087 1166 5.78e-7 SMART
VWA 1197 1376 2.02e-59 SMART
FN3 1385 1463 1.13e-9 SMART
FN3 1474 1554 1.07e-10 SMART
FN3 1566 1643 3.73e-10 SMART
FN3 1655 1734 2.94e-8 SMART
FN3 1755 1834 1.54e-11 SMART
FN3 1846 1924 1.45e-7 SMART
FN3 1936 2015 1.47e-8 SMART
FN3 2027 2106 1.21e-9 SMART
FN3 2118 2195 2.14e-10 SMART
FN3 2206 2285 3.85e-3 SMART
low complexity region 2292 2314 N/A INTRINSIC
VWA 2323 2503 2.61e-53 SMART
TSPN 2522 2714 1.13e-76 SMART
Pfam:Collagen 2747 2804 4.7e-9 PFAM
Pfam:Collagen 2802 2861 2.9e-9 PFAM
Pfam:Collagen 2838 2900 7.1e-8 PFAM
Pfam:Collagen 2935 2990 1.3e-8 PFAM
low complexity region 3007 3040 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XII collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XII collagen is a homotrimer found in association with type I collagen, an association that is thought to modify the interactions between collagen I fibrils and the surrounding matrix. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial perinatal lethality, decreased body weight, shorter and slender long bones, altered vertebrae structure, kyphosis, decreased bone strength, and abnormalities in osteoblast differentiation and bone matrix formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc4 T C 5: 52,845,400 L261P probably damaging Het
Aqp6 A G 15: 99,601,436 Y10C probably benign Het
Ccnb1ip1 A T 14: 50,792,205 N133K probably benign Het
Clip4 A T 17: 71,831,247 H433L probably damaging Het
Cntnap5c T A 17: 57,876,485 M62K probably benign Het
Col15a1 C T 4: 47,258,683 T358I probably benign Het
Coro7 A T 16: 4,631,889 D645E possibly damaging Het
Ctnnal1 C A 4: 56,817,067 W585L probably damaging Het
Ctnnd1 C A 2: 84,620,915 E114* probably null Het
Daam2 T A 17: 49,464,473 S882C probably damaging Het
Des T A 1: 75,362,984 S329T probably benign Het
Dido1 T C 2: 180,671,497 D994G probably benign Het
Dock3 A G 9: 106,994,062 V547A probably damaging Het
Ebf4 G A 2: 130,365,564 A643T probably damaging Het
Ect2 C A 3: 27,144,963 E194* probably null Het
Epb41l2 A G 10: 25,441,815 I77V possibly damaging Het
Fat3 A T 9: 16,006,528 probably null Het
Fbn2 T G 18: 58,048,920 D1803A probably damaging Het
Fbxo10 T C 4: 45,040,631 E858G probably benign Het
Fbxo24 C T 5: 137,619,650 R284Q probably benign Het
Fsip2 T A 2: 82,963,313 I425N possibly damaging Het
Fut9 A C 4: 25,620,090 Y241* probably null Het
Galr2 A G 11: 116,283,026 S161G possibly damaging Het
Gcc2 T A 10: 58,258,243 L14I probably damaging Het
Gm11127 A T 17: 36,056,785 D220E probably benign Het
Hdac11 G A 6: 91,173,214 V332I probably benign Het
Hdac7 T C 15: 97,802,072 probably null Het
Kif16b C T 2: 142,857,381 G93D probably damaging Het
Krtap11-1 C A 16: 89,570,768 C121F possibly damaging Het
Lacc1 T C 14: 77,035,077 Q93R probably damaging Het
Lama1 T C 17: 67,773,727 F1250S probably benign Het
Lmbrd2 A G 15: 9,172,115 E332G probably benign Het
Lrp2 C A 2: 69,459,548 C3649F probably damaging Het
Map1a T C 2: 121,304,376 V1653A probably benign Het
Mrpl1 T C 5: 96,231,794 probably null Het
Myo1b A G 1: 51,778,373 S577P probably damaging Het
Nedd4 T A 9: 72,743,638 probably null Het
Negr1 T A 3: 157,069,286 V213E probably damaging Het
Nlk T G 11: 78,590,966 Q223P probably benign Het
Ntn5 A G 7: 45,691,424 H162R probably damaging Het
Nupl2 T C 5: 24,167,402 S63P probably damaging Het
Obscn C A 11: 59,076,547 D477Y probably damaging Het
Olfr101 A T 17: 37,300,338 I28N possibly damaging Het
Olfr1037 T C 2: 86,084,881 S299G probably benign Het
Olfr1434 T C 19: 12,283,836 S263P probably damaging Het
Pabpn1 A G 14: 54,897,160 T280A probably damaging Het
Per3 A T 4: 151,042,737 V109E possibly damaging Het
Pira2 A C 7: 3,841,577 V485G probably benign Het
Pknox2 A G 9: 36,936,322 L133P probably damaging Het
Pros1 A C 16: 62,900,667 N195T probably damaging Het
Rffl T C 11: 82,806,151 K289E probably damaging Het
Ripk1 T A 13: 34,030,101 Y475* probably null Het
Ryr2 A G 13: 11,714,511 probably null Het
Sgk1 T A 10: 21,996,249 N241K probably damaging Het
Skint1 T A 4: 112,019,319 S146T probably benign Het
Sox30 G T 11: 45,981,073 D252Y probably damaging Het
Syngap1 A G 17: 26,963,038 Y1002C probably damaging Het
Tiam2 A G 17: 3,414,809 D271G possibly damaging Het
Ticam1 T C 17: 56,271,178 T306A probably benign Het
Tmem252 A G 19: 24,674,268 E67G probably benign Het
Tnxb T G 17: 34,685,707 F1149V probably damaging Het
Ubr4 A G 4: 139,421,078 probably null Het
Unc50 A G 1: 37,437,209 D150G probably benign Het
Ywhag A C 5: 135,911,629 L37R probably damaging Het
Zfp296 T C 7: 19,577,937 L123P probably benign Het
Zfp418 G T 7: 7,182,200 Q387H possibly damaging Het
Zfp882 T C 8: 71,913,155 F53L probably damaging Het
Other mutations in Col12a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col12a1 APN 9 79681537 missense possibly damaging 0.55
IGL00434:Col12a1 APN 9 79653332 missense probably benign 0.27
IGL00465:Col12a1 APN 9 79697581 missense probably damaging 1.00
IGL00568:Col12a1 APN 9 79651477 missense probably damaging 1.00
IGL00576:Col12a1 APN 9 79647652 missense probably damaging 1.00
IGL00580:Col12a1 APN 9 79692226 missense probably benign 0.05
IGL01015:Col12a1 APN 9 79633741 missense probably damaging 1.00
IGL01124:Col12a1 APN 9 79703847 missense probably damaging 1.00
IGL01138:Col12a1 APN 9 79678053 missense probably damaging 1.00
IGL01295:Col12a1 APN 9 79643926 missense probably damaging 1.00
IGL01630:Col12a1 APN 9 79657366 missense probably damaging 1.00
IGL01648:Col12a1 APN 9 79601169 makesense probably null
IGL01878:Col12a1 APN 9 79649975 missense possibly damaging 0.72
IGL01921:Col12a1 APN 9 79650017 missense possibly damaging 0.50
IGL02064:Col12a1 APN 9 79692372 missense probably benign 0.06
IGL02123:Col12a1 APN 9 79662458 critical splice donor site probably null
IGL02312:Col12a1 APN 9 79681515 missense probably damaging 1.00
IGL02320:Col12a1 APN 9 79616021 critical splice donor site probably null
IGL02328:Col12a1 APN 9 79682066 missense probably damaging 1.00
IGL02342:Col12a1 APN 9 79649896 splice site probably null
IGL02355:Col12a1 APN 9 79630711 splice site probably benign
IGL02362:Col12a1 APN 9 79630711 splice site probably benign
IGL02396:Col12a1 APN 9 79662583 missense probably benign
IGL02449:Col12a1 APN 9 79641469 missense probably damaging 1.00
IGL02682:Col12a1 APN 9 79699341 missense probably damaging 1.00
IGL02751:Col12a1 APN 9 79613859 unclassified probably benign
IGL02801:Col12a1 APN 9 79608414 splice site probably null
IGL03001:Col12a1 APN 9 79633673 missense probably damaging 1.00
IGL03027:Col12a1 APN 9 79641551 missense probably benign 0.40
IGL03090:Col12a1 APN 9 79678370 missense probably damaging 1.00
IGL03115:Col12a1 APN 9 79681437 missense probably damaging 1.00
IGL03220:Col12a1 APN 9 79699483 missense probably damaging 1.00
IGL03240:Col12a1 APN 9 79678383 splice site probably null
IGL03348:Col12a1 APN 9 79693430 missense possibly damaging 0.88
Feast UTSW 9 79700262 missense probably benign 0.00
hardly UTSW 9 79700350 nonsense probably null
hearty UTSW 9 79643966 missense probably damaging 1.00
Hefty UTSW 9 79662454 splice site probably benign
P0045:Col12a1 UTSW 9 79647611 missense probably damaging 0.99
PIT4260001:Col12a1 UTSW 9 79651380 critical splice donor site probably null
PIT4280001:Col12a1 UTSW 9 79678105 missense probably damaging 1.00
R0015:Col12a1 UTSW 9 79651385 missense probably damaging 1.00
R0015:Col12a1 UTSW 9 79651385 missense probably damaging 1.00
R0240:Col12a1 UTSW 9 79652033 missense probably benign 0.02
R0276:Col12a1 UTSW 9 79630741 nonsense probably null
R0309:Col12a1 UTSW 9 79600011 unclassified probably null
R0336:Col12a1 UTSW 9 79702345 missense probably damaging 0.98
R0376:Col12a1 UTSW 9 79693494 missense probably benign 0.10
R0413:Col12a1 UTSW 9 79699360 missense probably damaging 0.99
R0504:Col12a1 UTSW 9 79681468 missense possibly damaging 0.90
R0542:Col12a1 UTSW 9 79605328 critical splice donor site probably null
R0610:Col12a1 UTSW 9 79707848 missense probably benign
R0631:Col12a1 UTSW 9 79703376 missense probably damaging 1.00
R0637:Col12a1 UTSW 9 79656735 missense probably benign 0.00
R0667:Col12a1 UTSW 9 79628462 missense probably damaging 1.00
R0711:Col12a1 UTSW 9 79652035 missense probably damaging 1.00
R0717:Col12a1 UTSW 9 79612419 missense probably damaging 1.00
R0762:Col12a1 UTSW 9 79681374 splice site probably benign
R0787:Col12a1 UTSW 9 79638485 missense probably damaging 0.99
R0890:Col12a1 UTSW 9 79700402 missense probably damaging 0.97
R0900:Col12a1 UTSW 9 79684253 missense possibly damaging 0.91
R1109:Col12a1 UTSW 9 79699723 missense probably damaging 1.00
R1264:Col12a1 UTSW 9 79620089 missense probably benign 0.09
R1321:Col12a1 UTSW 9 79617709 nonsense probably null
R1344:Col12a1 UTSW 9 79699555 nonsense probably null
R1387:Col12a1 UTSW 9 79681375 splice site probably benign
R1511:Col12a1 UTSW 9 79699552 missense probably benign 0.02
R1523:Col12a1 UTSW 9 79660996 missense probably benign 0.01
R1526:Col12a1 UTSW 9 79656798 missense probably benign 0.44
R1564:Col12a1 UTSW 9 79613840 missense probably damaging 1.00
R1595:Col12a1 UTSW 9 79602254 missense probably damaging 1.00
R1603:Col12a1 UTSW 9 79612962 missense probably damaging 1.00
R1673:Col12a1 UTSW 9 79693538 missense probably benign 0.00
R1730:Col12a1 UTSW 9 79628378 missense possibly damaging 0.93
R1737:Col12a1 UTSW 9 79703451 missense probably damaging 1.00
R1739:Col12a1 UTSW 9 79633468 missense probably damaging 0.98
R1748:Col12a1 UTSW 9 79672997 missense probably benign 0.01
R1778:Col12a1 UTSW 9 79604585 splice site probably benign
R1845:Col12a1 UTSW 9 79697541 missense probably benign 0.09
R1864:Col12a1 UTSW 9 79627103 splice site probably null
R1876:Col12a1 UTSW 9 79678281 nonsense probably null
R1934:Col12a1 UTSW 9 79604522 nonsense probably null
R1942:Col12a1 UTSW 9 79635466 missense probably damaging 1.00
R1950:Col12a1 UTSW 9 79630549 missense possibly damaging 0.62
R2027:Col12a1 UTSW 9 79645793 critical splice acceptor site probably null
R2061:Col12a1 UTSW 9 79617705 missense possibly damaging 0.88
R2064:Col12a1 UTSW 9 79662454 splice site probably benign
R2070:Col12a1 UTSW 9 79647696 missense probably benign 0.00
R2112:Col12a1 UTSW 9 79643899 missense possibly damaging 0.93
R2209:Col12a1 UTSW 9 79692352 missense possibly damaging 0.83
R2275:Col12a1 UTSW 9 79635427 missense probably damaging 0.99
R2330:Col12a1 UTSW 9 79633657 missense probably damaging 0.99
R2373:Col12a1 UTSW 9 79656813 missense probably benign 0.03
R2425:Col12a1 UTSW 9 79678366 missense probably damaging 1.00
R2428:Col12a1 UTSW 9 79602251 missense probably benign 0.30
R2437:Col12a1 UTSW 9 79692219 missense probably damaging 0.97
R2831:Col12a1 UTSW 9 79697401 missense probably null 0.99
R2851:Col12a1 UTSW 9 79678332 missense probably damaging 1.00
R2872:Col12a1 UTSW 9 79699549 missense probably damaging 1.00
R2872:Col12a1 UTSW 9 79699549 missense probably damaging 1.00
R2874:Col12a1 UTSW 9 79699549 missense probably damaging 1.00
R2904:Col12a1 UTSW 9 79652025 missense probably damaging 1.00
R2905:Col12a1 UTSW 9 79652025 missense probably damaging 1.00
R2991:Col12a1 UTSW 9 79700265 missense probably damaging 1.00
R3402:Col12a1 UTSW 9 79643947 missense probably damaging 1.00
R3429:Col12a1 UTSW 9 79680311 missense probably benign
R3430:Col12a1 UTSW 9 79680311 missense probably benign
R3547:Col12a1 UTSW 9 79633416 missense probably damaging 1.00
R3789:Col12a1 UTSW 9 79639723 missense possibly damaging 0.96
R4091:Col12a1 UTSW 9 79702364 missense probably damaging 0.99
R4328:Col12a1 UTSW 9 79700389 missense possibly damaging 0.91
R4382:Col12a1 UTSW 9 79630741 nonsense probably null
R4392:Col12a1 UTSW 9 79662488 missense probably damaging 1.00
R4405:Col12a1 UTSW 9 79639965 critical splice donor site probably null
R4465:Col12a1 UTSW 9 79672910 missense possibly damaging 0.62
R4521:Col12a1 UTSW 9 79633357 missense probably benign 0.00
R4612:Col12a1 UTSW 9 79616057 missense probably damaging 0.99
R4613:Col12a1 UTSW 9 79647601 missense probably benign 0.03
R4649:Col12a1 UTSW 9 79639794 missense probably damaging 1.00
R4651:Col12a1 UTSW 9 79612946 missense probably damaging 1.00
R4652:Col12a1 UTSW 9 79612946 missense probably damaging 1.00
R4738:Col12a1 UTSW 9 79699282 missense probably damaging 1.00
R4745:Col12a1 UTSW 9 79652086 splice site probably null
R4761:Col12a1 UTSW 9 79657310 missense probably benign 0.34
R4784:Col12a1 UTSW 9 79678494 missense possibly damaging 0.50
R4785:Col12a1 UTSW 9 79678494 missense possibly damaging 0.50
R4809:Col12a1 UTSW 9 79693567 missense probably benign 0.10
R4821:Col12a1 UTSW 9 79715340 intron probably benign
R4925:Col12a1 UTSW 9 79674795 missense probably damaging 1.00
R4938:Col12a1 UTSW 9 79700350 nonsense probably null
R5034:Col12a1 UTSW 9 79657367 missense probably damaging 1.00
R5133:Col12a1 UTSW 9 79605174 missense probably damaging 0.99
R5138:Col12a1 UTSW 9 79643966 missense probably damaging 1.00
R5145:Col12a1 UTSW 9 79706300 missense probably benign 0.00
R5152:Col12a1 UTSW 9 79656748 missense probably damaging 1.00
R5237:Col12a1 UTSW 9 79700262 missense probably benign 0.00
R5268:Col12a1 UTSW 9 79678047 missense probably damaging 0.99
R5328:Col12a1 UTSW 9 79620060 missense probably damaging 0.96
R5372:Col12a1 UTSW 9 79678366 missense probably damaging 1.00
R5440:Col12a1 UTSW 9 79614363 missense probably benign 0.07
R5496:Col12a1 UTSW 9 79602185 splice site probably benign
R5537:Col12a1 UTSW 9 79699590 missense probably damaging 1.00
R5596:Col12a1 UTSW 9 79703759 missense probably damaging 1.00
R5677:Col12a1 UTSW 9 79699321 missense probably damaging 1.00
R5715:Col12a1 UTSW 9 79616065 nonsense probably null
R5796:Col12a1 UTSW 9 79703829 missense possibly damaging 0.73
R5829:Col12a1 UTSW 9 79633673 missense probably damaging 1.00
R5865:Col12a1 UTSW 9 79604478 missense probably benign 0.00
R5919:Col12a1 UTSW 9 79602298 missense probably damaging 0.99
R5981:Col12a1 UTSW 9 79678506 missense probably damaging 0.99
R5982:Col12a1 UTSW 9 79630560 missense probably damaging 1.00
R6027:Col12a1 UTSW 9 79656578 critical splice donor site probably null
R6090:Col12a1 UTSW 9 79692393 missense probably damaging 1.00
R6293:Col12a1 UTSW 9 79614358 missense probably benign 0.00
R6393:Col12a1 UTSW 9 79655485 missense probably damaging 0.99
R6457:Col12a1 UTSW 9 79645691 missense probably damaging 1.00
R6505:Col12a1 UTSW 9 79647605 missense probably damaging 0.98
R6508:Col12a1 UTSW 9 79649949 missense probably damaging 1.00
R6620:Col12a1 UTSW 9 79620049 missense probably damaging 0.98
R6718:Col12a1 UTSW 9 79699605 missense probably damaging 1.00
R6752:Col12a1 UTSW 9 79633424 missense possibly damaging 0.72
R6774:Col12a1 UTSW 9 79706337 missense possibly damaging 0.65
R6872:Col12a1 UTSW 9 79677234 missense probably damaging 1.00
R6884:Col12a1 UTSW 9 79639809 missense possibly damaging 0.92
R6935:Col12a1 UTSW 9 79700500 missense possibly damaging 0.76
R7198:Col12a1 UTSW 9 79650032 missense possibly damaging 0.56
R7296:Col12a1 UTSW 9 79682066 missense probably damaging 1.00
R7365:Col12a1 UTSW 9 79706360 missense probably damaging 0.99
R7466:Col12a1 UTSW 9 79655407 missense possibly damaging 0.95
R7516:Col12a1 UTSW 9 79612910 splice site probably null
R7584:Col12a1 UTSW 9 79703296 critical splice donor site probably null
R7670:Col12a1 UTSW 9 79631643 missense probably damaging 1.00
R7678:Col12a1 UTSW 9 79651486 missense probably damaging 0.99
R7702:Col12a1 UTSW 9 79681521 missense probably damaging 1.00
X0021:Col12a1 UTSW 9 79608485 missense probably damaging 1.00
X0058:Col12a1 UTSW 9 79602224 missense possibly damaging 0.66
X0061:Col12a1 UTSW 9 79612392 splice site probably null
Predicted Primers PCR Primer
(F):5'- GACCCATTCCTGTTGGCTAAATAC -3'
(R):5'- TTCCTACACGAAGGGAGAGG -3'

Sequencing Primer
(F):5'- CCTGTTGGCTAAATACTCTATAACTC -3'
(R):5'- AGAGGCAGACAAAAATGTTTTCC -3'
Posted On2017-03-31