Incidental Mutation 'R5974:Sox30'
ID471628
Institutional Source Beutler Lab
Gene Symbol Sox30
Ensembl Gene ENSMUSG00000040489
Gene NameSRY (sex determining region Y)-box 30
Synonyms
MMRRC Submission 044157-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5974 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location45980310-46017994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 45981073 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 252 (D252Y)
Ref Sequence ENSEMBL: ENSMUSP00000037519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049038]
Predicted Effect probably damaging
Transcript: ENSMUST00000049038
AA Change: D252Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037519
Gene: ENSMUSG00000040489
AA Change: D252Y

DomainStartEndE-ValueType
low complexity region 3 36 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 50 80 N/A INTRINSIC
low complexity region 92 104 N/A INTRINSIC
low complexity region 110 141 N/A INTRINSIC
low complexity region 210 220 N/A INTRINSIC
HMG 365 435 8.35e-24 SMART
low complexity region 523 539 N/A INTRINSIC
Blast:Pept_C1 572 734 1e-92 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein acts as a transcriptional regulator when present in a complex with other proteins. It can activate p53 transcription to promote tumor cell apoptosis in lung cancer. The protein may be involved in the differentiation of developing male germ cells. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, Apr 2015]
PHENOTYPE: Male mice homozygous for a null allele are infertile with arrest of spermiogenesis and azoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc4 T C 5: 52,845,400 L261P probably damaging Het
Aqp6 A G 15: 99,601,436 Y10C probably benign Het
Ccnb1ip1 A T 14: 50,792,205 N133K probably benign Het
Clip4 A T 17: 71,831,247 H433L probably damaging Het
Cntnap5c T A 17: 57,876,485 M62K probably benign Het
Col12a1 A G 9: 79,682,127 S1049P probably damaging Het
Col15a1 C T 4: 47,258,683 T358I probably benign Het
Coro7 A T 16: 4,631,889 D645E possibly damaging Het
Ctnnal1 C A 4: 56,817,067 W585L probably damaging Het
Ctnnd1 C A 2: 84,620,915 E114* probably null Het
Daam2 T A 17: 49,464,473 S882C probably damaging Het
Des T A 1: 75,362,984 S329T probably benign Het
Dido1 T C 2: 180,671,497 D994G probably benign Het
Dock3 A G 9: 106,994,062 V547A probably damaging Het
Ebf4 G A 2: 130,365,564 A643T probably damaging Het
Ect2 C A 3: 27,144,963 E194* probably null Het
Epb41l2 A G 10: 25,441,815 I77V possibly damaging Het
Fat3 A T 9: 16,006,528 probably null Het
Fbn2 T G 18: 58,048,920 D1803A probably damaging Het
Fbxo10 T C 4: 45,040,631 E858G probably benign Het
Fbxo24 C T 5: 137,619,650 R284Q probably benign Het
Fsip2 T A 2: 82,963,313 I425N possibly damaging Het
Fut9 A C 4: 25,620,090 Y241* probably null Het
Galr2 A G 11: 116,283,026 S161G possibly damaging Het
Gcc2 T A 10: 58,258,243 L14I probably damaging Het
Gm11127 A T 17: 36,056,785 D220E probably benign Het
Hdac11 G A 6: 91,173,214 V332I probably benign Het
Hdac7 T C 15: 97,802,072 probably null Het
Kif16b C T 2: 142,857,381 G93D probably damaging Het
Krtap11-1 C A 16: 89,570,768 C121F possibly damaging Het
Lacc1 T C 14: 77,035,077 Q93R probably damaging Het
Lama1 T C 17: 67,773,727 F1250S probably benign Het
Lmbrd2 A G 15: 9,172,115 E332G probably benign Het
Lrp2 C A 2: 69,459,548 C3649F probably damaging Het
Map1a T C 2: 121,304,376 V1653A probably benign Het
Mrpl1 T C 5: 96,231,794 probably null Het
Myo1b A G 1: 51,778,373 S577P probably damaging Het
Nedd4 T A 9: 72,743,638 probably null Het
Negr1 T A 3: 157,069,286 V213E probably damaging Het
Nlk T G 11: 78,590,966 Q223P probably benign Het
Ntn5 A G 7: 45,691,424 H162R probably damaging Het
Nupl2 T C 5: 24,167,402 S63P probably damaging Het
Obscn C A 11: 59,076,547 D477Y probably damaging Het
Olfr101 A T 17: 37,300,338 I28N possibly damaging Het
Olfr1037 T C 2: 86,084,881 S299G probably benign Het
Olfr1434 T C 19: 12,283,836 S263P probably damaging Het
Pabpn1 A G 14: 54,897,160 T280A probably damaging Het
Per3 A T 4: 151,042,737 V109E possibly damaging Het
Pira2 A C 7: 3,841,577 V485G probably benign Het
Pknox2 A G 9: 36,936,322 L133P probably damaging Het
Pros1 A C 16: 62,900,667 N195T probably damaging Het
Rffl T C 11: 82,806,151 K289E probably damaging Het
Ripk1 T A 13: 34,030,101 Y475* probably null Het
Ryr2 A G 13: 11,714,511 probably null Het
Sgk1 T A 10: 21,996,249 N241K probably damaging Het
Skint1 T A 4: 112,019,319 S146T probably benign Het
Syngap1 A G 17: 26,963,038 Y1002C probably damaging Het
Tiam2 A G 17: 3,414,809 D271G possibly damaging Het
Ticam1 T C 17: 56,271,178 T306A probably benign Het
Tmem252 A G 19: 24,674,268 E67G probably benign Het
Tnxb T G 17: 34,685,707 F1149V probably damaging Het
Ubr4 A G 4: 139,421,078 probably null Het
Unc50 A G 1: 37,437,209 D150G probably benign Het
Ywhag A C 5: 135,911,629 L37R probably damaging Het
Zfp296 T C 7: 19,577,937 L123P probably benign Het
Zfp418 G T 7: 7,182,200 Q387H possibly damaging Het
Zfp882 T C 8: 71,913,155 F53L probably damaging Het
Other mutations in Sox30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Sox30 APN 11 45991900 missense possibly damaging 0.95
IGL01449:Sox30 APN 11 45981342 missense probably damaging 1.00
IGL02411:Sox30 APN 11 45981124 nonsense probably null
IGL02601:Sox30 APN 11 45984762 missense possibly damaging 0.81
IGL02747:Sox30 APN 11 45980945 missense probably benign 0.00
IGL03403:Sox30 APN 11 46017208 missense probably damaging 1.00
R0104:Sox30 UTSW 11 45981314 missense possibly damaging 0.93
R1450:Sox30 UTSW 11 46017271 missense probably damaging 0.99
R2109:Sox30 UTSW 11 45991768 missense probably damaging 0.99
R2213:Sox30 UTSW 11 45984852 missense probably damaging 1.00
R3715:Sox30 UTSW 11 45984792 missense probably damaging 0.99
R4111:Sox30 UTSW 11 46017214 missense probably benign 0.09
R4723:Sox30 UTSW 11 45984765 missense probably benign 0.03
R5014:Sox30 UTSW 11 45991909 missense probably benign 0.01
R5408:Sox30 UTSW 11 45991867 missense possibly damaging 0.54
R6063:Sox30 UTSW 11 45991942 missense probably benign 0.04
R6948:Sox30 UTSW 11 46017339 missense probably damaging 1.00
R7242:Sox30 UTSW 11 45984520 intron probably null
R7258:Sox30 UTSW 11 45980552 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGCAAGTGAAGCCGGAAC -3'
(R):5'- GGCCCCTGAAACTGGATACG -3'

Sequencing Primer
(F):5'- AACAGGTGCTGCTGCTG -3'
(R):5'- TGGATACGGGCTCCAGGTG -3'
Posted On2017-03-31