Incidental Mutation 'R5974:Nlk'
ID471630
Institutional Source Beutler Lab
Gene Symbol Nlk
Ensembl Gene ENSMUSG00000017376
Gene Namenemo like kinase
Synonyms
MMRRC Submission 044157-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5974 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78567168-78697373 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 78590966 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 223 (Q223P)
Ref Sequence ENSEMBL: ENSMUSP00000119345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000142739]
Predicted Effect probably benign
Transcript: ENSMUST00000142739
AA Change: Q223P

PolyPhen 2 Score 0.391 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119345
Gene: ENSMUSG00000017376
AA Change: Q223P

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 27 55 N/A INTRINSIC
low complexity region 97 119 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
S_TKc 138 427 3.36e-89 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation die either during late gestation or around 4-6 weeks, depending on background. Long survivors exhibit growth retardation, neurological abnormalities, and aberrant differentiation of bone marrow stromal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc4 T C 5: 52,845,400 L261P probably damaging Het
Aqp6 A G 15: 99,601,436 Y10C probably benign Het
Ccnb1ip1 A T 14: 50,792,205 N133K probably benign Het
Clip4 A T 17: 71,831,247 H433L probably damaging Het
Cntnap5c T A 17: 57,876,485 M62K probably benign Het
Col12a1 A G 9: 79,682,127 S1049P probably damaging Het
Col15a1 C T 4: 47,258,683 T358I probably benign Het
Coro7 A T 16: 4,631,889 D645E possibly damaging Het
Ctnnal1 C A 4: 56,817,067 W585L probably damaging Het
Ctnnd1 C A 2: 84,620,915 E114* probably null Het
Daam2 T A 17: 49,464,473 S882C probably damaging Het
Des T A 1: 75,362,984 S329T probably benign Het
Dido1 T C 2: 180,671,497 D994G probably benign Het
Dock3 A G 9: 106,994,062 V547A probably damaging Het
Ebf4 G A 2: 130,365,564 A643T probably damaging Het
Ect2 C A 3: 27,144,963 E194* probably null Het
Epb41l2 A G 10: 25,441,815 I77V possibly damaging Het
Fat3 A T 9: 16,006,528 probably null Het
Fbn2 T G 18: 58,048,920 D1803A probably damaging Het
Fbxo10 T C 4: 45,040,631 E858G probably benign Het
Fbxo24 C T 5: 137,619,650 R284Q probably benign Het
Fsip2 T A 2: 82,963,313 I425N possibly damaging Het
Fut9 A C 4: 25,620,090 Y241* probably null Het
Galr2 A G 11: 116,283,026 S161G possibly damaging Het
Gcc2 T A 10: 58,258,243 L14I probably damaging Het
Gm11127 A T 17: 36,056,785 D220E probably benign Het
Hdac11 G A 6: 91,173,214 V332I probably benign Het
Hdac7 T C 15: 97,802,072 probably null Het
Kif16b C T 2: 142,857,381 G93D probably damaging Het
Krtap11-1 C A 16: 89,570,768 C121F possibly damaging Het
Lacc1 T C 14: 77,035,077 Q93R probably damaging Het
Lama1 T C 17: 67,773,727 F1250S probably benign Het
Lmbrd2 A G 15: 9,172,115 E332G probably benign Het
Lrp2 C A 2: 69,459,548 C3649F probably damaging Het
Map1a T C 2: 121,304,376 V1653A probably benign Het
Mrpl1 T C 5: 96,231,794 probably null Het
Myo1b A G 1: 51,778,373 S577P probably damaging Het
Nedd4 T A 9: 72,743,638 probably null Het
Negr1 T A 3: 157,069,286 V213E probably damaging Het
Ntn5 A G 7: 45,691,424 H162R probably damaging Het
Nupl2 T C 5: 24,167,402 S63P probably damaging Het
Obscn C A 11: 59,076,547 D477Y probably damaging Het
Olfr101 A T 17: 37,300,338 I28N possibly damaging Het
Olfr1037 T C 2: 86,084,881 S299G probably benign Het
Olfr1434 T C 19: 12,283,836 S263P probably damaging Het
Pabpn1 A G 14: 54,897,160 T280A probably damaging Het
Per3 A T 4: 151,042,737 V109E possibly damaging Het
Pira2 A C 7: 3,841,577 V485G probably benign Het
Pknox2 A G 9: 36,936,322 L133P probably damaging Het
Pros1 A C 16: 62,900,667 N195T probably damaging Het
Rffl T C 11: 82,806,151 K289E probably damaging Het
Ripk1 T A 13: 34,030,101 Y475* probably null Het
Ryr2 A G 13: 11,714,511 probably null Het
Sgk1 T A 10: 21,996,249 N241K probably damaging Het
Skint1 T A 4: 112,019,319 S146T probably benign Het
Sox30 G T 11: 45,981,073 D252Y probably damaging Het
Syngap1 A G 17: 26,963,038 Y1002C probably damaging Het
Tiam2 A G 17: 3,414,809 D271G possibly damaging Het
Ticam1 T C 17: 56,271,178 T306A probably benign Het
Tmem252 A G 19: 24,674,268 E67G probably benign Het
Tnxb T G 17: 34,685,707 F1149V probably damaging Het
Ubr4 A G 4: 139,421,078 probably null Het
Unc50 A G 1: 37,437,209 D150G probably benign Het
Ywhag A C 5: 135,911,629 L37R probably damaging Het
Zfp296 T C 7: 19,577,937 L123P probably benign Het
Zfp418 G T 7: 7,182,200 Q387H possibly damaging Het
Zfp882 T C 8: 71,913,155 F53L probably damaging Het
Other mutations in Nlk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01772:Nlk APN 11 78589375 missense probably damaging 1.00
IGL02186:Nlk APN 11 78586936 missense probably damaging 1.00
IGL02336:Nlk APN 11 78586937 missense probably damaging 1.00
IGL02739:Nlk APN 11 78574851 missense probably benign 0.05
IGL02953:Nlk APN 11 78626701 missense probably benign 0.02
Verne UTSW 11 78587066 nonsense probably null
R0276:Nlk UTSW 11 78571475 missense probably benign 0.01
R0324:Nlk UTSW 11 78572431 missense possibly damaging 0.71
R0636:Nlk UTSW 11 78695844 missense probably benign 0.34
R0639:Nlk UTSW 11 78572277 missense possibly damaging 0.86
R1776:Nlk UTSW 11 78587027 missense probably benign 0.03
R1886:Nlk UTSW 11 78586928 missense probably damaging 1.00
R4330:Nlk UTSW 11 78590948 missense possibly damaging 0.79
R4331:Nlk UTSW 11 78590948 missense possibly damaging 0.79
R6532:Nlk UTSW 11 78696055 missense probably damaging 0.99
R6669:Nlk UTSW 11 78587066 nonsense probably null
R6873:Nlk UTSW 11 78590948 missense possibly damaging 0.79
R7165:Nlk UTSW 11 78590967 nonsense probably null
R7475:Nlk UTSW 11 78583399 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGGATGCCAGGATAAAGTTC -3'
(R):5'- AGGAGATCATTTGGTTGCTTACTTC -3'

Sequencing Primer
(F):5'- GTTCAAACAAAGAACAGAATGTCTC -3'
(R):5'- AGGCACTGTTTAATCCTGTAGTC -3'
Posted On2017-03-31