Incidental Mutation 'R5974:Pabpn1'
ID471637
Institutional Source Beutler Lab
Gene Symbol Pabpn1
Ensembl Gene ENSMUSG00000022194
Gene Namepoly(A) binding protein, nuclear 1
Synonymspoly(A) binding protein II, Pabp3
MMRRC Submission 044157-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5974 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location54892500-54898169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54897160 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 280 (T280A)
Ref Sequence ENSEMBL: ENSMUSP00000133937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022808] [ENSMUST00000116476] [ENSMUST00000134077] [ENSMUST00000139985] [ENSMUST00000140691] [ENSMUST00000141446] [ENSMUST00000146271] [ENSMUST00000150975] [ENSMUST00000172557] [ENSMUST00000172695]
Predicted Effect probably damaging
Transcript: ENSMUST00000022808
AA Change: T253A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022808
Gene: ENSMUSG00000022194
AA Change: T253A

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 100 N/A INTRINSIC
coiled coil region 112 147 N/A INTRINSIC
RRM 169 241 4.19e-17 SMART
low complexity region 283 295 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000116476
AA Change: T253A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112177
Gene: ENSMUSG00000022194
AA Change: T253A

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 100 N/A INTRINSIC
coiled coil region 112 147 N/A INTRINSIC
RRM 169 241 4.19e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134077
AA Change: T284A

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117229
Gene: ENSMUSG00000092232
AA Change: T284A

DomainStartEndE-ValueType
BH4 6 32 1.28e-11 SMART
BCL 46 144 1.22e-45 SMART
low complexity region 155 169 N/A INTRINSIC
RRM 200 272 4.19e-17 SMART
low complexity region 314 326 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000139985
AA Change: T129A

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122432
Gene: ENSMUSG00000022194
AA Change: T129A

DomainStartEndE-ValueType
RRM 45 117 4.19e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000140691
AA Change: T157A

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115294
Gene: ENSMUSG00000022194
AA Change: T157A

DomainStartEndE-ValueType
coiled coil region 9 51 N/A INTRINSIC
RRM 73 145 4.19e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000141446
AA Change: T129A

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123305
Gene: ENSMUSG00000022194
AA Change: T129A

DomainStartEndE-ValueType
RRM 45 117 4.19e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146271
Predicted Effect probably damaging
Transcript: ENSMUST00000150975
AA Change: T280A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133937
Gene: ENSMUSG00000022194
AA Change: T280A

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 100 N/A INTRINSIC
coiled coil region 112 147 N/A INTRINSIC
RRM 169 241 3.23e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172557
AA Change: T129A

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133405
Gene: ENSMUSG00000022194
AA Change: T129A

DomainStartEndE-ValueType
RRM 45 117 4.19e-17 SMART
low complexity region 159 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172695
SMART Domains Protein: ENSMUSP00000133579
Gene: ENSMUSG00000022194

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 30 53 N/A INTRINSIC
low complexity region 59 73 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an abundant nuclear protein that binds with high affinity to nascent poly(A) tails. The protein is required for progressive and efficient polymerization of poly(A) tails at the 3' ends of eukaryotic transcripts and controls the size of the poly(A) tail to about 250 nt. At steady-state, this protein is localized in the nucleus whereas a different poly(A) binding protein is localized in the cytoplasm. This gene contains a GCG trinucleotide repeat at the 5' end of the coding region, and expansion of this repeat from the normal 6 copies to 8-13 copies leads to autosomal dominant oculopharyngeal muscular dystrophy (OPMD) disease. Related pseudogenes have been identified on chromosomes 19 and X. Read-through transcription also exists between this gene and the neighboring upstream BCL2-like 2 (BCL2L2) gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous KO and poly-alanine KI is embryonic lethal. Heterozygosity affects mitochondria and causes age- and muscle-specific muscle hypo- and hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Anapc4 T C 5: 52,845,400 L261P probably damaging Het
Aqp6 A G 15: 99,601,436 Y10C probably benign Het
Ccnb1ip1 A T 14: 50,792,205 N133K probably benign Het
Clip4 A T 17: 71,831,247 H433L probably damaging Het
Cntnap5c T A 17: 57,876,485 M62K probably benign Het
Col12a1 A G 9: 79,682,127 S1049P probably damaging Het
Col15a1 C T 4: 47,258,683 T358I probably benign Het
Coro7 A T 16: 4,631,889 D645E possibly damaging Het
Ctnnal1 C A 4: 56,817,067 W585L probably damaging Het
Ctnnd1 C A 2: 84,620,915 E114* probably null Het
Daam2 T A 17: 49,464,473 S882C probably damaging Het
Des T A 1: 75,362,984 S329T probably benign Het
Dido1 T C 2: 180,671,497 D994G probably benign Het
Dock3 A G 9: 106,994,062 V547A probably damaging Het
Ebf4 G A 2: 130,365,564 A643T probably damaging Het
Ect2 C A 3: 27,144,963 E194* probably null Het
Epb41l2 A G 10: 25,441,815 I77V possibly damaging Het
Fat3 A T 9: 16,006,528 probably null Het
Fbn2 T G 18: 58,048,920 D1803A probably damaging Het
Fbxo10 T C 4: 45,040,631 E858G probably benign Het
Fbxo24 C T 5: 137,619,650 R284Q probably benign Het
Fsip2 T A 2: 82,963,313 I425N possibly damaging Het
Fut9 A C 4: 25,620,090 Y241* probably null Het
Galr2 A G 11: 116,283,026 S161G possibly damaging Het
Gcc2 T A 10: 58,258,243 L14I probably damaging Het
Gm11127 A T 17: 36,056,785 D220E probably benign Het
Hdac11 G A 6: 91,173,214 V332I probably benign Het
Hdac7 T C 15: 97,802,072 probably null Het
Kif16b C T 2: 142,857,381 G93D probably damaging Het
Krtap11-1 C A 16: 89,570,768 C121F possibly damaging Het
Lacc1 T C 14: 77,035,077 Q93R probably damaging Het
Lama1 T C 17: 67,773,727 F1250S probably benign Het
Lmbrd2 A G 15: 9,172,115 E332G probably benign Het
Lrp2 C A 2: 69,459,548 C3649F probably damaging Het
Map1a T C 2: 121,304,376 V1653A probably benign Het
Mrpl1 T C 5: 96,231,794 probably null Het
Myo1b A G 1: 51,778,373 S577P probably damaging Het
Nedd4 T A 9: 72,743,638 probably null Het
Negr1 T A 3: 157,069,286 V213E probably damaging Het
Nlk T G 11: 78,590,966 Q223P probably benign Het
Ntn5 A G 7: 45,691,424 H162R probably damaging Het
Nupl2 T C 5: 24,167,402 S63P probably damaging Het
Obscn C A 11: 59,076,547 D477Y probably damaging Het
Olfr101 A T 17: 37,300,338 I28N possibly damaging Het
Olfr1037 T C 2: 86,084,881 S299G probably benign Het
Olfr1434 T C 19: 12,283,836 S263P probably damaging Het
Per3 A T 4: 151,042,737 V109E possibly damaging Het
Pira2 A C 7: 3,841,577 V485G probably benign Het
Pknox2 A G 9: 36,936,322 L133P probably damaging Het
Pros1 A C 16: 62,900,667 N195T probably damaging Het
Rffl T C 11: 82,806,151 K289E probably damaging Het
Ripk1 T A 13: 34,030,101 Y475* probably null Het
Ryr2 A G 13: 11,714,511 probably null Het
Sgk1 T A 10: 21,996,249 N241K probably damaging Het
Skint1 T A 4: 112,019,319 S146T probably benign Het
Sox30 G T 11: 45,981,073 D252Y probably damaging Het
Syngap1 A G 17: 26,963,038 Y1002C probably damaging Het
Tiam2 A G 17: 3,414,809 D271G possibly damaging Het
Ticam1 T C 17: 56,271,178 T306A probably benign Het
Tmem252 A G 19: 24,674,268 E67G probably benign Het
Tnxb T G 17: 34,685,707 F1149V probably damaging Het
Ubr4 A G 4: 139,421,078 probably null Het
Unc50 A G 1: 37,437,209 D150G probably benign Het
Ywhag A C 5: 135,911,629 L37R probably damaging Het
Zfp296 T C 7: 19,577,937 L123P probably benign Het
Zfp418 G T 7: 7,182,200 Q387H possibly damaging Het
Zfp882 T C 8: 71,913,155 F53L probably damaging Het
Other mutations in Pabpn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2038:Pabpn1 UTSW 14 54897152 missense probably damaging 0.99
R2081:Pabpn1 UTSW 14 54895658 missense probably damaging 1.00
R5236:Pabpn1 UTSW 14 54894942 missense possibly damaging 0.73
R7681:Pabpn1 UTSW 14 54898042 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATAGAGTTCTCGGACAAAGAGTC -3'
(R):5'- ACAAGGGAGTAAGGGTCCTC -3'

Sequencing Primer
(F):5'- AGAGTCAGTGAGGACGTCCC -3'
(R):5'- GGAGTAAGGGTCCTCAGGTG -3'
Posted On2017-03-31