Incidental Mutation 'R0501:Itpr3'
ID 47164
Institutional Source Beutler Lab
Gene Symbol Itpr3
Ensembl Gene ENSMUSG00000042644
Gene Name inositol 1,4,5-triphosphate receptor 3
Synonyms Itpr-3, Ip3r3, tf
MMRRC Submission 038696-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0501 (G1)
Quality Score 195
Status Not validated
Chromosome 17
Chromosomal Location 27276278-27341197 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 27326263 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1344 (H1344Q)
Ref Sequence ENSEMBL: ENSMUSP00000038150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049308]
AlphaFold P70227
PDB Structure Crystal structure of the ligand binding suppressor domain of type 3 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000049308
AA Change: H1344Q

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644
AA Change: H1344Q

DomainStartEndE-ValueType
MIR 113 167 7.75e-6 SMART
MIR 174 224 1.16e-4 SMART
MIR 232 288 1.21e-7 SMART
MIR 295 402 9.38e-14 SMART
Pfam:RYDR_ITPR 473 670 7.8e-64 PFAM
low complexity region 881 889 N/A INTRINSIC
Pfam:RYDR_ITPR 1175 1333 5.8e-16 PFAM
low complexity region 1549 1567 N/A INTRINSIC
low complexity region 1831 1851 N/A INTRINSIC
Pfam:RIH_assoc 1863 1973 2.6e-34 PFAM
transmembrane domain 2203 2225 N/A INTRINSIC
Pfam:Ion_trans 2235 2527 8.1e-20 PFAM
coiled coil region 2631 2660 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 73,209,216 (GRCm39) S415P probably benign Het
Adam19 C T 11: 46,013,957 (GRCm39) P316S probably damaging Het
Adamts2 A G 11: 50,558,972 (GRCm39) D229G probably benign Het
Adcy10 C T 1: 165,337,959 (GRCm39) P191L probably damaging Het
Adgrv1 T C 13: 81,707,269 (GRCm39) Y1379C probably damaging Het
Akap9 T C 5: 4,020,685 (GRCm39) L1132P probably damaging Het
Aoah A G 13: 21,189,243 (GRCm39) T489A probably benign Het
Apc2 T C 10: 80,150,958 (GRCm39) L1975P probably damaging Het
Bpifa5 A T 2: 154,005,616 (GRCm39) D66V probably benign Het
C230029F24Rik T C 1: 49,374,629 (GRCm39) noncoding transcript Het
Cacna1h A T 17: 25,607,641 (GRCm39) V892E probably damaging Het
Car4 G A 11: 84,854,268 (GRCm39) V72I probably benign Het
Cfap91 C G 16: 38,155,997 (GRCm39) M75I probably damaging Het
Chst3 A G 10: 60,022,049 (GRCm39) L266P probably damaging Het
Ckap2l G A 2: 129,127,411 (GRCm39) R256W possibly damaging Het
Cntn4 A T 6: 106,595,296 (GRCm39) D471V probably damaging Het
Cntrob G A 11: 69,213,694 (GRCm39) S32F probably damaging Het
Cpne7 T A 8: 123,852,994 (GRCm39) N200K possibly damaging Het
Creb3l3 C A 10: 80,922,416 (GRCm39) M271I probably benign Het
Csmd1 T A 8: 17,077,339 (GRCm39) Q106L probably damaging Het
D7Ertd443e G A 7: 133,896,701 (GRCm39) T563I probably damaging Het
Dmac1 T G 4: 75,196,413 (GRCm39) N26H unknown Het
Dop1b T C 16: 93,549,750 (GRCm39) F230L probably benign Het
Dpp6 T A 5: 27,930,604 (GRCm39) I812N probably damaging Het
Fabp12 T C 3: 10,315,203 (GRCm39) D48G probably benign Het
Fbn1 G A 2: 125,143,669 (GRCm39) T2820M probably benign Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Fcho2 A T 13: 98,901,023 (GRCm39) S277R possibly damaging Het
Fmo2 A G 1: 162,704,497 (GRCm39) S470P probably benign Het
Gm17541 T G 12: 4,739,730 (GRCm39) probably benign Het
Gm4353 A T 7: 115,682,706 (GRCm39) Y292N probably benign Het
Igkv4-71 A T 6: 69,220,290 (GRCm39) I69N probably damaging Het
Insrr G T 3: 87,717,991 (GRCm39) A871S probably benign Het
Irs2 C T 8: 11,056,396 (GRCm39) V679M probably damaging Het
Kcnma1 T C 14: 23,361,784 (GRCm39) M1074V possibly damaging Het
Kif1a G A 1: 92,983,967 (GRCm39) R602W probably damaging Het
Kif21b A T 1: 136,090,837 (GRCm39) D1215V probably benign Het
Mapk13 G A 17: 28,995,327 (GRCm39) V183M probably damaging Het
Mbp C T 18: 82,593,322 (GRCm39) S100F probably damaging Het
Mcm6 A G 1: 128,283,373 (GRCm39) I44T probably benign Het
Ncor1 T A 11: 62,264,148 (GRCm39) D418V possibly damaging Het
Nid2 T A 14: 19,839,736 (GRCm39) probably null Het
Nolc1 T C 19: 46,067,359 (GRCm39) V80A probably damaging Het
Or10a5 A T 7: 106,635,439 (GRCm39) T26S probably benign Het
Or10ak14 C A 4: 118,611,027 (GRCm39) C238F probably benign Het
Or12e9 A T 2: 87,201,896 (GRCm39) R7W probably damaging Het
Or13e8 A C 4: 43,697,079 (GRCm39) C31W probably damaging Het
Or1j1 A T 2: 36,702,492 (GRCm39) L204* probably null Het
Or2ag1 A T 7: 106,313,810 (GRCm39) M26K probably benign Het
Or2ag18 G A 7: 106,405,018 (GRCm39) S217F probably damaging Het
Or4a68 T C 2: 89,270,060 (GRCm39) T188A probably benign Het
Or4e1 T A 14: 52,701,383 (GRCm39) M1L possibly damaging Het
Or5d14 A T 2: 87,880,815 (GRCm39) I51N probably damaging Het
Or5m12 A G 2: 85,735,348 (GRCm39) F17L probably damaging Het
Or7g35 T A 9: 19,495,914 (GRCm39) I27N probably damaging Het
Pcgf3 T A 5: 108,622,978 (GRCm39) C38S probably damaging Het
Pdia4 A T 6: 47,777,936 (GRCm39) V352E probably damaging Het
Pik3c2a C A 7: 115,953,290 (GRCm39) V1202L probably damaging Het
Rbm15 G T 3: 107,239,846 (GRCm39) A184E possibly damaging Het
Rsph3a T A 17: 8,197,952 (GRCm39) L442* probably null Het
Scg2 G C 1: 79,413,320 (GRCm39) L468V probably damaging Het
Sdk1 A T 5: 141,923,473 (GRCm39) I365L probably benign Het
Setdb1 A G 3: 95,246,140 (GRCm39) V595A probably benign Het
Skic3 A C 13: 76,295,925 (GRCm39) M1063L probably benign Het
Slc22a22 T A 15: 57,113,046 (GRCm39) T398S probably benign Het
Stk11 C A 10: 79,962,119 (GRCm39) P217Q probably damaging Het
Tes G A 6: 17,097,557 (GRCm39) D222N probably benign Het
Tmem132e T A 11: 82,325,894 (GRCm39) I206N possibly damaging Het
Tmem214 G T 5: 31,029,876 (GRCm39) R251L probably damaging Het
Tmem253 T A 14: 52,256,036 (GRCm39) I105N probably damaging Het
Toe1 A G 4: 116,664,682 (GRCm39) V12A probably benign Het
Top1 C A 2: 160,556,079 (GRCm39) H513N probably damaging Het
Tph1 G T 7: 46,299,412 (GRCm39) Y376* probably null Het
Trim45 T A 3: 100,830,535 (GRCm39) L103Q probably damaging Het
Ttn T A 2: 76,774,518 (GRCm39) probably null Het
Twnk T C 19: 44,996,185 (GRCm39) V206A probably damaging Het
Ube2z A G 11: 95,941,114 (GRCm39) S343P probably damaging Het
Vmn2r8 T C 5: 108,951,049 (GRCm39) D132G probably benign Het
Wdr20rt A T 12: 65,272,581 (GRCm39) T15S probably benign Het
Wdr59 C T 8: 112,185,579 (GRCm39) R841Q possibly damaging Het
Wdtc1 A G 4: 133,036,151 (GRCm39) F130L possibly damaging Het
Wnk1 C T 6: 119,939,764 (GRCm39) R43Q probably damaging Het
Ythdf3 T C 3: 16,259,236 (GRCm39) L461P probably damaging Het
Zcchc2 T G 1: 105,943,821 (GRCm39) F462C possibly damaging Het
Other mutations in Itpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Itpr3 APN 17 27,302,603 (GRCm39) missense probably benign 0.05
IGL00980:Itpr3 APN 17 27,329,930 (GRCm39) missense probably benign
IGL01151:Itpr3 APN 17 27,310,503 (GRCm39) missense probably damaging 1.00
IGL01289:Itpr3 APN 17 27,318,739 (GRCm39) missense probably damaging 0.99
IGL01403:Itpr3 APN 17 27,337,569 (GRCm39) missense probably damaging 0.97
IGL01666:Itpr3 APN 17 27,336,152 (GRCm39) missense probably benign 0.02
IGL01897:Itpr3 APN 17 27,330,236 (GRCm39) missense probably damaging 1.00
IGL02003:Itpr3 APN 17 27,340,449 (GRCm39) missense probably damaging 1.00
IGL02012:Itpr3 APN 17 27,323,069 (GRCm39) missense probably benign
IGL02063:Itpr3 APN 17 27,338,997 (GRCm39) missense probably benign 0.01
IGL02146:Itpr3 APN 17 27,336,249 (GRCm39) missense probably damaging 1.00
IGL02158:Itpr3 APN 17 27,317,416 (GRCm39) missense probably damaging 1.00
IGL02177:Itpr3 APN 17 27,318,588 (GRCm39) missense possibly damaging 0.74
IGL02247:Itpr3 APN 17 27,317,153 (GRCm39) missense probably damaging 1.00
IGL02606:Itpr3 APN 17 27,333,486 (GRCm39) splice site probably benign
IGL02651:Itpr3 APN 17 27,325,372 (GRCm39) missense probably damaging 0.99
IGL02902:Itpr3 APN 17 27,323,530 (GRCm39) missense probably benign 0.21
IGL03001:Itpr3 APN 17 27,308,586 (GRCm39) splice site probably benign
IGL03004:Itpr3 APN 17 27,316,952 (GRCm39) missense possibly damaging 0.90
IGL03065:Itpr3 APN 17 27,310,907 (GRCm39) missense probably damaging 1.00
IGL03117:Itpr3 APN 17 27,338,240 (GRCm39) missense probably damaging 1.00
IGL03181:Itpr3 APN 17 27,330,242 (GRCm39) missense probably benign
IGL03404:Itpr3 APN 17 27,310,492 (GRCm39) missense probably damaging 1.00
Allure UTSW 17 27,326,277 (GRCm39) missense probably damaging 1.00
alopecia UTSW 17 27,314,452 (GRCm39) missense probably damaging 0.98
Beauty UTSW 17 27,325,316 (GRCm39) missense probably damaging 1.00
Opuesto UTSW 17 27,306,566 (GRCm39) missense probably damaging 1.00
Paradox UTSW 17 27,317,145 (GRCm39) missense probably damaging 1.00
Pulchritude UTSW 17 27,305,934 (GRCm39) missense probably damaging 0.97
R0010:Itpr3 UTSW 17 27,339,951 (GRCm39) missense probably damaging 1.00
R0055:Itpr3 UTSW 17 27,317,296 (GRCm39) missense probably damaging 1.00
R0068:Itpr3 UTSW 17 27,323,034 (GRCm39) splice site probably benign
R0068:Itpr3 UTSW 17 27,323,034 (GRCm39) splice site probably benign
R0104:Itpr3 UTSW 17 27,314,966 (GRCm39) missense probably benign 0.01
R0195:Itpr3 UTSW 17 27,333,088 (GRCm39) missense probably damaging 1.00
R0212:Itpr3 UTSW 17 27,308,293 (GRCm39) missense probably damaging 1.00
R0454:Itpr3 UTSW 17 27,332,793 (GRCm39) missense probably benign
R0485:Itpr3 UTSW 17 27,330,903 (GRCm39) missense probably damaging 0.98
R0781:Itpr3 UTSW 17 27,329,529 (GRCm39) missense probably benign 0.00
R0890:Itpr3 UTSW 17 27,307,985 (GRCm39) nonsense probably null
R1028:Itpr3 UTSW 17 27,310,343 (GRCm39) missense probably benign 0.04
R1144:Itpr3 UTSW 17 27,333,897 (GRCm39) missense probably benign 0.01
R1347:Itpr3 UTSW 17 27,330,535 (GRCm39) missense probably benign 0.02
R1347:Itpr3 UTSW 17 27,330,535 (GRCm39) missense probably benign 0.02
R1458:Itpr3 UTSW 17 27,337,346 (GRCm39) missense probably benign 0.01
R1463:Itpr3 UTSW 17 27,336,128 (GRCm39) splice site probably benign
R1472:Itpr3 UTSW 17 27,333,199 (GRCm39) missense probably benign 0.09
R1529:Itpr3 UTSW 17 27,324,459 (GRCm39) splice site probably null
R1533:Itpr3 UTSW 17 27,314,534 (GRCm39) missense possibly damaging 0.71
R1537:Itpr3 UTSW 17 27,333,121 (GRCm39) missense possibly damaging 0.96
R1618:Itpr3 UTSW 17 27,335,581 (GRCm39) critical splice acceptor site probably null
R1672:Itpr3 UTSW 17 27,307,987 (GRCm39) missense probably benign
R1726:Itpr3 UTSW 17 27,330,664 (GRCm39) missense probably damaging 0.96
R1865:Itpr3 UTSW 17 27,338,997 (GRCm39) missense probably benign 0.01
R1940:Itpr3 UTSW 17 27,330,191 (GRCm39) missense probably damaging 1.00
R2023:Itpr3 UTSW 17 27,321,785 (GRCm39) missense possibly damaging 0.76
R2063:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2064:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2065:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2067:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2068:Itpr3 UTSW 17 27,317,050 (GRCm39) missense probably benign 0.19
R2219:Itpr3 UTSW 17 27,334,027 (GRCm39) missense probably benign
R2248:Itpr3 UTSW 17 27,334,033 (GRCm39) missense probably damaging 1.00
R2291:Itpr3 UTSW 17 27,332,553 (GRCm39) missense possibly damaging 0.92
R2320:Itpr3 UTSW 17 27,314,889 (GRCm39) missense probably benign
R2864:Itpr3 UTSW 17 27,310,525 (GRCm39) missense probably benign 0.01
R2865:Itpr3 UTSW 17 27,310,525 (GRCm39) missense probably benign 0.01
R3778:Itpr3 UTSW 17 27,314,446 (GRCm39) missense possibly damaging 0.57
R3881:Itpr3 UTSW 17 27,332,814 (GRCm39) missense probably benign 0.01
R3979:Itpr3 UTSW 17 27,310,546 (GRCm39) missense probably damaging 1.00
R3979:Itpr3 UTSW 17 27,304,105 (GRCm39) missense probably benign 0.23
R4224:Itpr3 UTSW 17 27,326,232 (GRCm39) missense probably damaging 1.00
R4259:Itpr3 UTSW 17 27,325,298 (GRCm39) missense probably damaging 1.00
R4321:Itpr3 UTSW 17 27,330,948 (GRCm39) missense probably benign 0.00
R4466:Itpr3 UTSW 17 27,325,316 (GRCm39) missense probably damaging 1.00
R4493:Itpr3 UTSW 17 27,323,586 (GRCm39) missense probably damaging 1.00
R4597:Itpr3 UTSW 17 27,312,257 (GRCm39) missense probably damaging 1.00
R4823:Itpr3 UTSW 17 27,304,121 (GRCm39) missense probably benign 0.30
R4921:Itpr3 UTSW 17 27,316,979 (GRCm39) missense probably damaging 1.00
R4974:Itpr3 UTSW 17 27,302,582 (GRCm39) missense probably damaging 0.96
R5063:Itpr3 UTSW 17 27,308,885 (GRCm39) missense possibly damaging 0.94
R5079:Itpr3 UTSW 17 27,317,397 (GRCm39) missense probably damaging 1.00
R5303:Itpr3 UTSW 17 27,335,663 (GRCm39) missense probably benign 0.38
R5518:Itpr3 UTSW 17 27,306,566 (GRCm39) missense probably damaging 1.00
R5521:Itpr3 UTSW 17 27,326,308 (GRCm39) missense probably benign 0.09
R5566:Itpr3 UTSW 17 27,334,926 (GRCm39) missense possibly damaging 0.71
R5567:Itpr3 UTSW 17 27,322,880 (GRCm39) missense possibly damaging 0.66
R5579:Itpr3 UTSW 17 27,332,493 (GRCm39) missense probably damaging 1.00
R5610:Itpr3 UTSW 17 27,337,540 (GRCm39) missense probably benign 0.42
R5658:Itpr3 UTSW 17 27,326,852 (GRCm39) missense possibly damaging 0.74
R5856:Itpr3 UTSW 17 27,325,379 (GRCm39) missense probably damaging 1.00
R5872:Itpr3 UTSW 17 27,305,950 (GRCm39) missense probably benign 0.02
R5878:Itpr3 UTSW 17 27,329,836 (GRCm39) missense probably benign 0.01
R5889:Itpr3 UTSW 17 27,334,039 (GRCm39) missense probably damaging 0.99
R5907:Itpr3 UTSW 17 27,336,867 (GRCm39) missense probably damaging 1.00
R5930:Itpr3 UTSW 17 27,329,895 (GRCm39) missense possibly damaging 0.49
R5987:Itpr3 UTSW 17 27,323,575 (GRCm39) missense probably damaging 1.00
R6029:Itpr3 UTSW 17 27,317,145 (GRCm39) missense probably damaging 1.00
R6195:Itpr3 UTSW 17 27,305,934 (GRCm39) missense probably damaging 0.97
R6213:Itpr3 UTSW 17 27,330,174 (GRCm39) missense probably benign 0.03
R6233:Itpr3 UTSW 17 27,305,934 (GRCm39) missense probably damaging 0.97
R6376:Itpr3 UTSW 17 27,314,449 (GRCm39) missense possibly damaging 0.94
R6514:Itpr3 UTSW 17 27,310,344 (GRCm39) missense probably benign
R6515:Itpr3 UTSW 17 27,310,344 (GRCm39) missense probably benign
R6516:Itpr3 UTSW 17 27,310,344 (GRCm39) missense probably benign
R6955:Itpr3 UTSW 17 27,340,441 (GRCm39) missense probably damaging 1.00
R7002:Itpr3 UTSW 17 27,329,554 (GRCm39) missense probably benign 0.00
R7064:Itpr3 UTSW 17 27,308,269 (GRCm39) missense probably damaging 1.00
R7257:Itpr3 UTSW 17 27,337,535 (GRCm39) missense probably benign 0.00
R7349:Itpr3 UTSW 17 27,326,786 (GRCm39) splice site probably null
R7469:Itpr3 UTSW 17 27,340,028 (GRCm39) missense possibly damaging 0.74
R7493:Itpr3 UTSW 17 27,313,774 (GRCm39) missense probably benign 0.09
R7510:Itpr3 UTSW 17 27,308,013 (GRCm39) missense probably damaging 0.97
R7565:Itpr3 UTSW 17 27,329,862 (GRCm39) missense probably benign 0.01
R7616:Itpr3 UTSW 17 27,307,951 (GRCm39) missense probably damaging 1.00
R7728:Itpr3 UTSW 17 27,317,088 (GRCm39) missense probably damaging 1.00
R7779:Itpr3 UTSW 17 27,315,037 (GRCm39) missense probably damaging 1.00
R7788:Itpr3 UTSW 17 27,337,571 (GRCm39) nonsense probably null
R7871:Itpr3 UTSW 17 27,336,153 (GRCm39) missense probably damaging 1.00
R7889:Itpr3 UTSW 17 27,335,751 (GRCm39) missense probably damaging 1.00
R7966:Itpr3 UTSW 17 27,331,002 (GRCm39) critical splice donor site probably null
R8065:Itpr3 UTSW 17 27,329,836 (GRCm39) missense probably benign 0.01
R8067:Itpr3 UTSW 17 27,329,836 (GRCm39) missense probably benign 0.01
R8230:Itpr3 UTSW 17 27,326,711 (GRCm39) critical splice donor site probably null
R8263:Itpr3 UTSW 17 27,334,887 (GRCm39) nonsense probably null
R8264:Itpr3 UTSW 17 27,323,086 (GRCm39) synonymous silent
R8269:Itpr3 UTSW 17 27,312,258 (GRCm39) missense possibly damaging 0.60
R8271:Itpr3 UTSW 17 27,306,622 (GRCm39) missense probably damaging 1.00
R8316:Itpr3 UTSW 17 27,325,199 (GRCm39) missense possibly damaging 0.50
R8354:Itpr3 UTSW 17 27,334,893 (GRCm39) missense possibly damaging 0.74
R8413:Itpr3 UTSW 17 27,330,900 (GRCm39) missense probably damaging 1.00
R8437:Itpr3 UTSW 17 27,326,277 (GRCm39) missense probably damaging 1.00
R8676:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8679:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8846:Itpr3 UTSW 17 27,330,996 (GRCm39) missense probably damaging 1.00
R8884:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8885:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8886:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8887:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8888:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8891:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8896:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R8975:Itpr3 UTSW 17 27,335,628 (GRCm39) missense possibly damaging 0.56
R9025:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9026:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9063:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9087:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9088:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9089:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9090:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9091:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9200:Itpr3 UTSW 17 27,326,636 (GRCm39) missense probably damaging 0.99
R9270:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9271:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9294:Itpr3 UTSW 17 27,330,191 (GRCm39) missense probably damaging 1.00
R9389:Itpr3 UTSW 17 27,314,899 (GRCm39) missense possibly damaging 0.84
R9433:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9434:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9443:Itpr3 UTSW 17 27,324,523 (GRCm39) missense probably damaging 1.00
R9472:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9474:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9475:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9476:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9477:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9507:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9508:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9511:Itpr3 UTSW 17 27,337,651 (GRCm39) unclassified probably benign
R9694:Itpr3 UTSW 17 27,334,927 (GRCm39) missense probably damaging 0.99
R9789:Itpr3 UTSW 17 27,308,915 (GRCm39) missense probably benign 0.15
V7732:Itpr3 UTSW 17 27,330,000 (GRCm39) splice site probably null
V7732:Itpr3 UTSW 17 27,329,998 (GRCm39) splice site probably benign
Z1088:Itpr3 UTSW 17 27,332,502 (GRCm39) missense possibly damaging 0.50
Z1177:Itpr3 UTSW 17 27,338,961 (GRCm39) missense probably damaging 1.00
Z1177:Itpr3 UTSW 17 27,333,903 (GRCm39) missense probably damaging 1.00
Z31818:Itpr3 UTSW 17 27,314,452 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGTCACGGTCTTCTTTTCCTGACAAG -3'
(R):5'- TTTTAACCTGGGCAGCAGGCAC -3'

Sequencing Primer
(F):5'- TGTCACAGCTGACCAATGC -3'
(R):5'- ACCTCCGTGATACAATCCTCG -3'
Posted On 2013-06-12