Mutagenetix > Incidental Mutation

Incidental Mutation 'R5974:Pros1'

471644

Institutional Source

Beutler Lab

Gene Symbol

Pros1

Ensembl Gene

ENSMUSG00000022912

Gene Name

protein S (alpha)

Synonyms

protein S

MMRRC Submission

044157-MU

Accession Numbers

Genbank: NM_011173; MGI: 1095733

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5974 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62854307-62929346 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 62900667 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Threonine at position 195 (N195T)

Ref Sequence

ENSEMBL: ENSMUSP00000023629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023629]

AlphaFold

Q08761

Predicted Effect

probably damaging
Transcript: ENSMUST00000023629
AA Change: N195T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: N195T

Domain	Start	End	E-Value	Type
GLA	23	86	3.63e-31	SMART
EGF	120	155	4.39e-2	SMART
EGF_CA	157	200	6.91e-9	SMART
EGF_CA	201	242	5.23e-9	SMART
EGF_CA	243	283	1.1e-7	SMART
LamG	321	458	8.55e-22	SMART
LamG	506	646	1.57e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155940

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Anapc4	T	C	5: 52,845,400	L261P	probably damaging	Het
Aqp6	A	G	15: 99,601,436	Y10C	probably benign	Het
Ccnb1ip1	A	T	14: 50,792,205	N133K	probably benign	Het
Clip4	A	T	17: 71,831,247	H433L	probably damaging	Het
Cntnap5c	T	A	17: 57,876,485	M62K	probably benign	Het
Col12a1	A	G	9: 79,682,127	S1049P	probably damaging	Het
Col15a1	C	T	4: 47,258,683	T358I	probably benign	Het
Coro7	A	T	16: 4,631,889	D645E	possibly damaging	Het
Ctnnal1	C	A	4: 56,817,067	W585L	probably damaging	Het
Ctnnd1	C	A	2: 84,620,915	E114*	probably null	Het
Daam2	T	A	17: 49,464,473	S882C	probably damaging	Het
Des	T	A	1: 75,362,984	S329T	probably benign	Het
Dido1	T	C	2: 180,671,497	D994G	probably benign	Het
Dock3	A	G	9: 106,994,062	V547A	probably damaging	Het
Ebf4	G	A	2: 130,365,564	A643T	probably damaging	Het
Ect2	C	A	3: 27,144,963	E194*	probably null	Het
Epb41l2	A	G	10: 25,441,815	I77V	possibly damaging	Het
Fat3	A	T	9: 16,006,528		probably null	Het
Fbn2	T	G	18: 58,048,920	D1803A	probably damaging	Het
Fbxo10	T	C	4: 45,040,631	E858G	probably benign	Het
Fbxo24	C	T	5: 137,619,650	R284Q	probably benign	Het
Fsip2	T	A	2: 82,963,313	I425N	possibly damaging	Het
Fut9	A	C	4: 25,620,090	Y241*	probably null	Het
Galr2	A	G	11: 116,283,026	S161G	possibly damaging	Het
Gcc2	T	A	10: 58,258,243	L14I	probably damaging	Het
Gm11127	A	T	17: 36,056,785	D220E	probably benign	Het
Hdac11	G	A	6: 91,173,214	V332I	probably benign	Het
Hdac7	T	C	15: 97,802,072		probably null	Het
Kif16b	C	T	2: 142,857,381	G93D	probably damaging	Het
Krtap11-1	C	A	16: 89,570,768	C121F	possibly damaging	Het
Lacc1	T	C	14: 77,035,077	Q93R	probably damaging	Het
Lama1	T	C	17: 67,773,727	F1250S	probably benign	Het
Lmbrd2	A	G	15: 9,172,115	E332G	probably benign	Het
Lrp2	C	A	2: 69,459,548	C3649F	probably damaging	Het
Map1a	T	C	2: 121,304,376	V1653A	probably benign	Het
Mrpl1	T	C	5: 96,231,794		probably null	Het
Myo1b	A	G	1: 51,778,373	S577P	probably damaging	Het
Nedd4	T	A	9: 72,743,638		probably null	Het
Negr1	T	A	3: 157,069,286	V213E	probably damaging	Het
Nlk	T	G	11: 78,590,966	Q223P	probably benign	Het
Ntn5	A	G	7: 45,691,424	H162R	probably damaging	Het
Nupl2	T	C	5: 24,167,402	S63P	probably damaging	Het
Obscn	C	A	11: 59,076,547	D477Y	probably damaging	Het
Olfr101	A	T	17: 37,300,338	I28N	possibly damaging	Het
Olfr1037	T	C	2: 86,084,881	S299G	probably benign	Het
Olfr1434	T	C	19: 12,283,836	S263P	probably damaging	Het
Pabpn1	A	G	14: 54,897,160	T280A	probably damaging	Het
Per3	A	T	4: 151,042,737	V109E	possibly damaging	Het
Pira2	A	C	7: 3,841,577	V485G	probably benign	Het
Pknox2	A	G	9: 36,936,322	L133P	probably damaging	Het
Rffl	T	C	11: 82,806,151	K289E	probably damaging	Het
Ripk1	T	A	13: 34,030,101	Y475*	probably null	Het
Ryr2	A	G	13: 11,714,511		probably null	Het
Sgk1	T	A	10: 21,996,249	N241K	probably damaging	Het
Skint1	T	A	4: 112,019,319	S146T	probably benign	Het
Sox30	G	T	11: 45,981,073	D252Y	probably damaging	Het
Syngap1	A	G	17: 26,963,038	Y1002C	probably damaging	Het
Tiam2	A	G	17: 3,414,809	D271G	possibly damaging	Het
Ticam1	T	C	17: 56,271,178	T306A	probably benign	Het
Tmem252	A	G	19: 24,674,268	E67G	probably benign	Het
Tnxb	T	G	17: 34,685,707	F1149V	probably damaging	Het
Ubr4	A	G	4: 139,421,078		probably null	Het
Unc50	A	G	1: 37,437,209	D150G	probably benign	Het
Ywhag	A	C	5: 135,911,629	L37R	probably damaging	Het
Zfp296	T	C	7: 19,577,937	L123P	probably benign	Het
Zfp418	G	T	7: 7,182,200	Q387H	possibly damaging	Het
Zfp882	T	C	8: 71,913,155	F53L	probably damaging	Het

Other mutations in Pros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00937:Pros1	APN	16	62910045	missense	probably damaging	0.99
IGL01300:Pros1	APN	16	62913811	missense	possibly damaging	0.85
IGL02709:Pros1	APN	16	62898945	missense	probably damaging	0.99
IGL03080:Pros1	APN	16	62918143	missense	probably damaging	0.98
IGL03095:Pros1	APN	16	62907769	nonsense	probably null
F6893:Pros1	UTSW	16	62924639	missense	probably damaging	0.98
R0124:Pros1	UTSW	16	62913946	missense	possibly damaging	0.95
R0517:Pros1	UTSW	16	62903518	missense	probably benign	0.03
R1113:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1308:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1355:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1370:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1517:Pros1	UTSW	16	62885512	missense	probably damaging	0.98
R1866:Pros1	UTSW	16	62928135	missense	possibly damaging	0.86
R1876:Pros1	UTSW	16	62903518	missense	probably damaging	0.96
R2255:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R2364:Pros1	UTSW	16	62913848	missense	probably damaging	0.99
R2369:Pros1	UTSW	16	62928069	missense	probably damaging	1.00
R2979:Pros1	UTSW	16	62913866	missense	probably damaging	0.99
R3724:Pros1	UTSW	16	62900329	missense	possibly damaging	0.86
R4056:Pros1	UTSW	16	62900645	nonsense	probably null
R4556:Pros1	UTSW	16	62900673	missense	possibly damaging	0.95
R4688:Pros1	UTSW	16	62889007	critical splice donor site	probably null
R4850:Pros1	UTSW	16	62885524	missense	probably damaging	0.98
R4923:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R5008:Pros1	UTSW	16	62928185	missense	possibly damaging	0.53
R5370:Pros1	UTSW	16	62913976	missense	probably benign	0.01
R5580:Pros1	UTSW	16	62926326	critical splice acceptor site	probably null
R5930:Pros1	UTSW	16	62928061	missense	probably damaging	0.96
R6233:Pros1	UTSW	16	62898921	missense	possibly damaging	0.47
R6949:Pros1	UTSW	16	62924575	missense	probably benign	0.01
R7055:Pros1	UTSW	16	62928102	missense	possibly damaging	0.85
R7347:Pros1	UTSW	16	62919523	missense	probably damaging	0.97
R7375:Pros1	UTSW	16	62924550	missense	probably damaging	0.96
R7419:Pros1	UTSW	16	62928070	nonsense	probably null
R7980:Pros1	UTSW	16	62928153	missense	possibly damaging	0.86
R8234:Pros1	UTSW	16	62928177	missense	possibly damaging	0.73
R8479:Pros1	UTSW	16	62907739	missense	probably damaging	1.00
R8514:Pros1	UTSW	16	62910109	missense	probably benign	0.03
R8827:Pros1	UTSW	16	62926464	missense	probably benign	0.13
R9131:Pros1	UTSW	16	62928034	missense	probably damaging	0.96
R9484:Pros1	UTSW	16	62924524	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GGATGGTTGCATTACAAATCATCTG -3'
(R):5'- GTTCTCGGGCATATGCACAC -3'

Sequencing Primer
(F):5'- CTGCAGCCAGATTTGTG -3'
(R):5'- CCCAAGAAGAACATGAAATAGTCTTG -3'

Posted On

2017-03-31