Incidental Mutation 'R5975:Ntsr1'
ID 471667
Institutional Source Beutler Lab
Gene Symbol Ntsr1
Ensembl Gene ENSMUSG00000027568
Gene Name neurotensin receptor 1
Synonyms Ntsr1, NTR1, NTR-1, NT-1R
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R5975 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 180499976-180544980 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 180500788 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 124 (L124Q)
Ref Sequence ENSEMBL: ENSMUSP00000127548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029084] [ENSMUST00000170448]
AlphaFold O88319
Predicted Effect probably damaging
Transcript: ENSMUST00000029084
AA Change: L124Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029084
Gene: ENSMUSG00000027568
AA Change: L124Q

DomainStartEndE-ValueType
low complexity region 31 49 N/A INTRINSIC
Pfam:7tm_1 80 369 7.5e-55 PFAM
Pfam:7TM_GPCR_Srv 82 386 1e-8 PFAM
low complexity region 392 398 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170448
AA Change: L124Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127548
Gene: ENSMUSG00000027568
AA Change: L124Q

DomainStartEndE-ValueType
low complexity region 31 49 N/A INTRINSIC
Pfam:7tm_4 70 283 6.7e-9 PFAM
Pfam:7tm_1 80 369 2e-51 PFAM
Pfam:7TM_GPCR_Srv 83 386 1.8e-8 PFAM
low complexity region 392 398 N/A INTRINSIC
Meta Mutation Damage Score 0.8999 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotensin receptor 1 belongs to the large superfamily of G-protein coupled receptors. NTSR1 mediates the multiple functions of neurotensin, such as hypotension, hyperglycemia, hypothermia, antinociception, and regulation of intestinal motility and secretion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice deficient for this marker have normal baseline prepulse inhibition responses and acoustic startle responses. Mice are heavier, eat more, and have lower body temperatures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,969,221 T2233I possibly damaging Het
9430038I01Rik T C 7: 137,387,292 probably benign Het
Abhd14a A T 9: 106,443,951 probably null Het
Actn2 T C 13: 12,340,497 N2D probably benign Het
Adcy9 T C 16: 4,311,567 E722G probably damaging Het
Alox12 C A 11: 70,242,783 V572L possibly damaging Het
Ankrd11 T C 8: 122,889,749 I2434V possibly damaging Het
Anks1 T A 17: 27,991,447 probably null Het
Bpifa3 T A 2: 154,136,321 S148T probably damaging Het
Bptf C T 11: 107,035,864 probably benign Het
Cabin1 A T 10: 75,657,839 L1655H probably damaging Het
Ccdc13 G T 9: 121,827,235 Q171K probably benign Het
Ccdc33 T A 9: 58,117,478 Q155L possibly damaging Het
Cckbr G A 7: 105,470,619 G280E probably benign Het
Cdk11b G A 4: 155,648,240 probably benign Het
Celsr1 G T 15: 85,919,038 probably null Het
Cenpj A T 14: 56,564,066 I150N possibly damaging Het
Cep135 C A 5: 76,640,890 A1110E possibly damaging Het
Chit1 C A 1: 134,146,626 H224N probably damaging Het
Cul5 T C 9: 53,622,793 R680G probably damaging Het
Dhx58 C A 11: 100,702,209 R224L probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dnah5 A C 15: 28,234,282 D279A probably damaging Het
Enpp3 A G 10: 24,774,842 W799R probably benign Het
Ercc5 A G 1: 44,173,406 T675A probably benign Het
Farsa T A 8: 84,864,432 probably null Het
Fbxw15 A T 9: 109,555,252 V397D probably damaging Het
Fcrl5 G A 3: 87,442,103 V62I probably benign Het
Gart A G 16: 91,624,336 S815P probably damaging Het
Glrx5 A G 12: 105,040,323 N111S possibly damaging Het
Gm10845 A G 14: 79,863,174 noncoding transcript Het
Gm11639 A G 11: 104,687,549 probably benign Het
Gm8882 A G 6: 132,362,073 S61P unknown Het
Gm9925 T A 18: 74,065,516 probably benign Het
Gsdme T C 6: 50,227,359 N206S probably benign Het
Helz2 T C 2: 181,231,050 S2459G probably benign Het
Hnrnpul1 A G 7: 25,754,359 S93P possibly damaging Het
Ints2 A T 11: 86,226,748 I716N possibly damaging Het
Lmnb2 G A 10: 80,905,128 Q248* probably null Het
Map3k7cl A G 16: 87,570,321 I32V probably benign Het
Mfsd4b4 A T 10: 39,892,470 I255N probably benign Het
Myh6 A G 14: 54,950,508 I1163T probably benign Het
Nphs1 A T 7: 30,466,115 T636S possibly damaging Het
Obscn C T 11: 59,122,619 probably null Het
P4ha2 G A 11: 54,126,412 probably null Het
Pcdha9 T A 18: 36,999,111 V411D probably benign Het
Pkhd1l1 A T 15: 44,525,988 I1380F probably damaging Het
Plekha1 T C 7: 130,892,253 V106A probably benign Het
Plekhm1 A T 11: 103,376,691 V818E possibly damaging Het
Pprc1 T G 19: 46,065,370 probably benign Het
Prmt9 T C 8: 77,561,018 probably benign Het
Rab26 T C 17: 24,530,399 N193D possibly damaging Het
Rnf111 A G 9: 70,429,580 S942P probably damaging Het
Scgb2b18 T C 7: 33,173,225 T52A probably damaging Het
Syt3 C T 7: 44,392,763 Q349* probably null Het
Tas2r107 T C 6: 131,659,780 N102S probably benign Het
Tas2r126 T A 6: 42,435,000 Y156N possibly damaging Het
Tcaf2 A T 6: 42,642,778 I105N probably benign Het
Tet1 A C 10: 62,879,773 M81R probably benign Het
Togaram2 T C 17: 71,729,205 Y897H probably damaging Het
Trerf1 A T 17: 47,314,271 noncoding transcript Het
Ttn G A 2: 76,761,235 T12703I probably damaging Het
Unc79 A G 12: 103,125,626 K1735E possibly damaging Het
Usp54 G A 14: 20,583,351 T372I possibly damaging Het
Wdr24 T C 17: 25,827,128 S476P probably benign Het
Wdr78 G A 4: 103,049,589 P676S probably benign Het
Zbtb1 T C 12: 76,386,275 I345T possibly damaging Het
Zcrb1 T A 15: 93,395,615 I29L probably benign Het
Zfp341 T A 2: 154,630,441 C315S probably damaging Het
Zfp623 C A 15: 75,948,163 R323S probably benign Het
Zfp831 T A 2: 174,644,092 Y187N possibly damaging Het
Other mutations in Ntsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Ntsr1 APN 2 180542542 missense probably damaging 0.99
IGL01765:Ntsr1 APN 2 180538717 missense possibly damaging 0.56
IGL02137:Ntsr1 APN 2 180538835 critical splice donor site probably null
IGL02321:Ntsr1 APN 2 180538834 critical splice donor site probably null
IGL03349:Ntsr1 APN 2 180500502 missense probably benign
R0482:Ntsr1 UTSW 2 180501056 missense possibly damaging 0.54
R0542:Ntsr1 UTSW 2 180542581 missense probably damaging 1.00
R1081:Ntsr1 UTSW 2 180538756 missense probably benign 0.14
R1241:Ntsr1 UTSW 2 180500601 missense probably damaging 1.00
R1540:Ntsr1 UTSW 2 180542647 missense probably damaging 0.99
R3718:Ntsr1 UTSW 2 180542706 missense probably benign 0.00
R4206:Ntsr1 UTSW 2 180500752 missense probably damaging 1.00
R5481:Ntsr1 UTSW 2 180541520 missense possibly damaging 0.79
R5703:Ntsr1 UTSW 2 180500433 missense probably damaging 0.98
R6643:Ntsr1 UTSW 2 180500926 missense probably damaging 1.00
R6754:Ntsr1 UTSW 2 180542683 missense probably benign 0.00
R7295:Ntsr1 UTSW 2 180500932 missense probably damaging 1.00
R7316:Ntsr1 UTSW 2 180500752 missense probably damaging 1.00
R7765:Ntsr1 UTSW 2 180538817 missense probably damaging 0.99
R7822:Ntsr1 UTSW 2 180538690 missense probably damaging 1.00
R8087:Ntsr1 UTSW 2 180500172 unclassified probably benign
R8555:Ntsr1 UTSW 2 180538677 missense probably benign 0.08
R9447:Ntsr1 UTSW 2 180538747 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACCTGGACGTGAACACTGAC -3'
(R):5'- GCACTGATGAATTTCTTGGTGC -3'

Sequencing Primer
(F):5'- ATTCCAAGGTGCTGGTGACC -3'
(R):5'- ATGAATTTCTTGGTGCGGCTGC -3'
Posted On 2017-03-31