Incidental Mutation 'R5975:Wdr78'
ID 471672
Institutional Source Beutler Lab
Gene Symbol Wdr78
Ensembl Gene ENSMUSG00000035126
Gene Name WD repeat domain 78
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R5975 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 103038065-103114555 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 103049589 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 676 (P676S)
Ref Sequence ENSEMBL: ENSMUSP00000102481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036451] [ENSMUST00000036557] [ENSMUST00000106868] [ENSMUST00000116316]
AlphaFold E9PYY5
Predicted Effect probably benign
Transcript: ENSMUST00000036451
SMART Domains Protein: ENSMUSP00000037588
Gene: ENSMUSG00000035126

DomainStartEndE-ValueType
low complexity region 12 20 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 138 157 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
low complexity region 382 390 N/A INTRINSIC
low complexity region 399 423 N/A INTRINSIC
internal_repeat_1 447 466 2.11e-5 PROSPERO
WD40 485 524 1.85e-3 SMART
WD40 534 581 5.7e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036557
SMART Domains Protein: ENSMUSP00000042272
Gene: ENSMUSG00000035126

DomainStartEndE-ValueType
low complexity region 59 67 N/A INTRINSIC
low complexity region 76 100 N/A INTRINSIC
WD40 133 172 9.24e-4 SMART
WD40 182 229 5.7e1 SMART
low complexity region 249 261 N/A INTRINSIC
Blast:WD40 262 296 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106868
AA Change: P676S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000102481
Gene: ENSMUSG00000035126
AA Change: P676S

DomainStartEndE-ValueType
low complexity region 12 20 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 138 157 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
low complexity region 382 390 N/A INTRINSIC
low complexity region 399 423 N/A INTRINSIC
internal_repeat_1 447 466 8.61e-5 PROSPERO
WD40 485 524 1.85e-3 SMART
WD40 534 581 5.7e1 SMART
low complexity region 601 613 N/A INTRINSIC
Blast:WD40 614 648 3e-12 BLAST
WD40 652 692 2.38e-6 SMART
WD40 695 734 1.48e-2 SMART
WD40 739 779 6.14e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116316
SMART Domains Protein: ENSMUSP00000112018
Gene: ENSMUSG00000035126

DomainStartEndE-ValueType
low complexity region 12 20 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 138 157 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
low complexity region 382 390 N/A INTRINSIC
low complexity region 399 423 N/A INTRINSIC
internal_repeat_1 447 466 2.11e-5 PROSPERO
WD40 485 524 1.85e-3 SMART
WD40 534 581 5.7e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138960
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (80/82)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,969,221 T2233I possibly damaging Het
9430038I01Rik T C 7: 137,387,292 probably benign Het
Abhd14a A T 9: 106,443,951 probably null Het
Actn2 T C 13: 12,340,497 N2D probably benign Het
Adcy9 T C 16: 4,311,567 E722G probably damaging Het
Alox12 C A 11: 70,242,783 V572L possibly damaging Het
Ankrd11 T C 8: 122,889,749 I2434V possibly damaging Het
Anks1 T A 17: 27,991,447 probably null Het
Bpifa3 T A 2: 154,136,321 S148T probably damaging Het
Bptf C T 11: 107,035,864 probably benign Het
Cabin1 A T 10: 75,657,839 L1655H probably damaging Het
Ccdc13 G T 9: 121,827,235 Q171K probably benign Het
Ccdc33 T A 9: 58,117,478 Q155L possibly damaging Het
Cckbr G A 7: 105,470,619 G280E probably benign Het
Cdk11b G A 4: 155,648,240 probably benign Het
Celsr1 G T 15: 85,919,038 probably null Het
Cenpj A T 14: 56,564,066 I150N possibly damaging Het
Cep135 C A 5: 76,640,890 A1110E possibly damaging Het
Chit1 C A 1: 134,146,626 H224N probably damaging Het
Cul5 T C 9: 53,622,793 R680G probably damaging Het
Dhx58 C A 11: 100,702,209 R224L probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dnah5 A C 15: 28,234,282 D279A probably damaging Het
Enpp3 A G 10: 24,774,842 W799R probably benign Het
Ercc5 A G 1: 44,173,406 T675A probably benign Het
Farsa T A 8: 84,864,432 probably null Het
Fbxw15 A T 9: 109,555,252 V397D probably damaging Het
Fcrl5 G A 3: 87,442,103 V62I probably benign Het
Gart A G 16: 91,624,336 S815P probably damaging Het
Glrx5 A G 12: 105,040,323 N111S possibly damaging Het
Gm10845 A G 14: 79,863,174 noncoding transcript Het
Gm11639 A G 11: 104,687,549 probably benign Het
Gm8882 A G 6: 132,362,073 S61P unknown Het
Gm9925 T A 18: 74,065,516 probably benign Het
Gsdme T C 6: 50,227,359 N206S probably benign Het
Helz2 T C 2: 181,231,050 S2459G probably benign Het
Hnrnpul1 A G 7: 25,754,359 S93P possibly damaging Het
Ints2 A T 11: 86,226,748 I716N possibly damaging Het
Lmnb2 G A 10: 80,905,128 Q248* probably null Het
Map3k7cl A G 16: 87,570,321 I32V probably benign Het
Mfsd4b4 A T 10: 39,892,470 I255N probably benign Het
Myh6 A G 14: 54,950,508 I1163T probably benign Het
Nphs1 A T 7: 30,466,115 T636S possibly damaging Het
Ntsr1 T A 2: 180,500,788 L124Q probably damaging Het
Obscn C T 11: 59,122,619 probably null Het
P4ha2 G A 11: 54,126,412 probably null Het
Pcdha9 T A 18: 36,999,111 V411D probably benign Het
Pkhd1l1 A T 15: 44,525,988 I1380F probably damaging Het
Plekha1 T C 7: 130,892,253 V106A probably benign Het
Plekhm1 A T 11: 103,376,691 V818E possibly damaging Het
Pprc1 T G 19: 46,065,370 probably benign Het
Prmt9 T C 8: 77,561,018 probably benign Het
Rab26 T C 17: 24,530,399 N193D possibly damaging Het
Rnf111 A G 9: 70,429,580 S942P probably damaging Het
Scgb2b18 T C 7: 33,173,225 T52A probably damaging Het
Syt3 C T 7: 44,392,763 Q349* probably null Het
Tas2r107 T C 6: 131,659,780 N102S probably benign Het
Tas2r126 T A 6: 42,435,000 Y156N possibly damaging Het
Tcaf2 A T 6: 42,642,778 I105N probably benign Het
Tet1 A C 10: 62,879,773 M81R probably benign Het
Togaram2 T C 17: 71,729,205 Y897H probably damaging Het
Trerf1 A T 17: 47,314,271 noncoding transcript Het
Ttn G A 2: 76,761,235 T12703I probably damaging Het
Unc79 A G 12: 103,125,626 K1735E possibly damaging Het
Usp54 G A 14: 20,583,351 T372I possibly damaging Het
Wdr24 T C 17: 25,827,128 S476P probably benign Het
Zbtb1 T C 12: 76,386,275 I345T possibly damaging Het
Zcrb1 T A 15: 93,395,615 I29L probably benign Het
Zfp341 T A 2: 154,630,441 C315S probably damaging Het
Zfp623 C A 15: 75,948,163 R323S probably benign Het
Zfp831 T A 2: 174,644,092 Y187N possibly damaging Het
Other mutations in Wdr78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Wdr78 APN 4 103103242 missense possibly damaging 0.77
IGL01508:Wdr78 APN 4 103072687 missense possibly damaging 0.94
IGL01509:Wdr78 APN 4 103072687 missense possibly damaging 0.94
IGL01511:Wdr78 APN 4 103048361 missense possibly damaging 0.81
IGL01693:Wdr78 APN 4 103087330 splice site probably null
IGL01731:Wdr78 APN 4 103062435 missense probably benign 0.01
IGL02033:Wdr78 APN 4 103066293 missense possibly damaging 0.58
IGL02100:Wdr78 APN 4 103050149 missense probably damaging 1.00
IGL02218:Wdr78 APN 4 103096774 missense probably damaging 1.00
IGL02226:Wdr78 APN 4 103090398 missense probably benign 0.00
IGL02476:Wdr78 APN 4 103087348 missense possibly damaging 0.46
IGL02929:Wdr78 APN 4 103059991 nonsense probably null
R0070:Wdr78 UTSW 4 103059934 missense probably damaging 1.00
R0377:Wdr78 UTSW 4 103048259 missense probably damaging 1.00
R0433:Wdr78 UTSW 4 103103253 missense probably benign 0.41
R0518:Wdr78 UTSW 4 103064530 nonsense probably null
R0538:Wdr78 UTSW 4 103096618 missense possibly damaging 0.65
R0624:Wdr78 UTSW 4 103072857 splice site probably benign
R0894:Wdr78 UTSW 4 103049386 intron probably benign
R1463:Wdr78 UTSW 4 103087418 missense possibly damaging 0.95
R1818:Wdr78 UTSW 4 103072657 missense possibly damaging 0.67
R2073:Wdr78 UTSW 4 103050193 missense probably damaging 1.00
R2075:Wdr78 UTSW 4 103050193 missense probably damaging 1.00
R2436:Wdr78 UTSW 4 103066352 missense probably benign 0.01
R2851:Wdr78 UTSW 4 103096661 missense probably benign 0.12
R2852:Wdr78 UTSW 4 103096661 missense probably benign 0.12
R2853:Wdr78 UTSW 4 103050158 missense possibly damaging 0.90
R4491:Wdr78 UTSW 4 103066399 missense probably benign 0.04
R4792:Wdr78 UTSW 4 103072684 missense possibly damaging 0.94
R5223:Wdr78 UTSW 4 103049403 missense possibly damaging 0.87
R5290:Wdr78 UTSW 4 103049533 missense probably benign 0.00
R5465:Wdr78 UTSW 4 103049561 missense probably damaging 1.00
R6239:Wdr78 UTSW 4 103066443 missense probably benign
R6304:Wdr78 UTSW 4 103087356 missense probably benign 0.35
R6456:Wdr78 UTSW 4 103049549 missense probably benign 0.00
R6467:Wdr78 UTSW 4 103049561 missense probably damaging 1.00
R6813:Wdr78 UTSW 4 103048326 missense probably benign 0.26
R7161:Wdr78 UTSW 4 103096616 missense probably benign 0.28
R7198:Wdr78 UTSW 4 103062413 missense probably damaging 0.98
R7208:Wdr78 UTSW 4 103066352 missense probably benign 0.00
R7320:Wdr78 UTSW 4 103050187 missense possibly damaging 0.68
R7742:Wdr78 UTSW 4 103090433 missense probably benign
R7939:Wdr78 UTSW 4 103096601 nonsense probably null
R8120:Wdr78 UTSW 4 103066334 missense probably damaging 1.00
R8353:Wdr78 UTSW 4 103059916 missense possibly damaging 0.63
R8453:Wdr78 UTSW 4 103059916 missense possibly damaging 0.63
R8813:Wdr78 UTSW 4 103090500 missense possibly damaging 0.53
R8870:Wdr78 UTSW 4 103087332 critical splice donor site probably null
R8909:Wdr78 UTSW 4 103087410 missense possibly damaging 0.91
R8957:Wdr78 UTSW 4 103096753 missense probably damaging 1.00
R9035:Wdr78 UTSW 4 103048302 nonsense probably null
R9060:Wdr78 UTSW 4 103090553 missense probably benign 0.06
R9132:Wdr78 UTSW 4 103059733 missense probably damaging 1.00
R9141:Wdr78 UTSW 4 103049546 missense probably damaging 0.98
R9188:Wdr78 UTSW 4 103082135 missense
R9426:Wdr78 UTSW 4 103049546 missense probably damaging 0.98
Z1176:Wdr78 UTSW 4 103072771 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACTTACGTGCTGATCTGAAGG -3'
(R):5'- GGAAGAGTCCATGTGAGGTC -3'

Sequencing Primer
(F):5'- GTGCTGATCTGAAGGTCCCAAATC -3'
(R):5'- GTCTTGTTTTCAGTTAAAGCAGTTCC -3'
Posted On 2017-03-31