Incidental Mutation 'R5975:Tas2r126'
ID471676
Institutional Source Beutler Lab
Gene Symbol Tas2r126
Ensembl Gene ENSMUSG00000048284
Gene Nametaste receptor, type 2, member 126
SynonymsT2R12, mt2r35, T2R26, mGR26, Tas2r26
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5975 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42434535-42435464 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42435000 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 156 (Y156N)
Ref Sequence ENSEMBL: ENSMUSP00000056581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059534]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059534
AA Change: Y156N

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000056581
Gene: ENSMUSG00000048284
AA Change: Y156N

DomainStartEndE-ValueType
Pfam:TAS2R 1 303 2.5e-97 PFAM
Meta Mutation Damage Score 0.2120 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (80/82)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,969,221 T2233I possibly damaging Het
9430038I01Rik T C 7: 137,387,292 probably benign Het
Abhd14a A T 9: 106,443,951 probably null Het
Actn2 T C 13: 12,340,497 N2D probably benign Het
Adcy9 T C 16: 4,311,567 E722G probably damaging Het
Alox12 C A 11: 70,242,783 V572L possibly damaging Het
Ankrd11 T C 8: 122,889,749 I2434V possibly damaging Het
Anks1 T A 17: 27,991,447 probably null Het
Bpifa3 T A 2: 154,136,321 S148T probably damaging Het
Bptf C T 11: 107,035,864 probably benign Het
Cabin1 A T 10: 75,657,839 L1655H probably damaging Het
Ccdc13 G T 9: 121,827,235 Q171K probably benign Het
Ccdc33 T A 9: 58,117,478 Q155L possibly damaging Het
Cckbr G A 7: 105,470,619 G280E probably benign Het
Cdk11b G A 4: 155,648,240 probably benign Het
Celsr1 G T 15: 85,919,038 probably null Het
Cenpj A T 14: 56,564,066 I150N possibly damaging Het
Cep135 C A 5: 76,640,890 A1110E possibly damaging Het
Chit1 C A 1: 134,146,626 H224N probably damaging Het
Cul5 T C 9: 53,622,793 R680G probably damaging Het
Dhx58 C A 11: 100,702,209 R224L probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dnah5 A C 15: 28,234,282 D279A probably damaging Het
Enpp3 A G 10: 24,774,842 W799R probably benign Het
Ercc5 A G 1: 44,173,406 T675A probably benign Het
Farsa T A 8: 84,864,432 probably null Het
Fbxw15 A T 9: 109,555,252 V397D probably damaging Het
Fcrl5 G A 3: 87,442,103 V62I probably benign Het
Gart A G 16: 91,624,336 S815P probably damaging Het
Glrx5 A G 12: 105,040,323 N111S possibly damaging Het
Gm10845 A G 14: 79,863,174 noncoding transcript Het
Gm11639 A G 11: 104,687,549 probably benign Het
Gm8882 A G 6: 132,362,073 S61P unknown Het
Gm9925 T A 18: 74,065,516 probably benign Het
Gsdme T C 6: 50,227,359 N206S probably benign Het
Helz2 T C 2: 181,231,050 S2459G probably benign Het
Hnrnpul1 A G 7: 25,754,359 S93P possibly damaging Het
Ints2 A T 11: 86,226,748 I716N possibly damaging Het
Lmnb2 G A 10: 80,905,128 Q248* probably null Het
Map3k7cl A G 16: 87,570,321 I32V probably benign Het
Mfsd4b4 A T 10: 39,892,470 I255N probably benign Het
Myh6 A G 14: 54,950,508 I1163T probably benign Het
Nphs1 A T 7: 30,466,115 T636S possibly damaging Het
Ntsr1 T A 2: 180,500,788 L124Q probably damaging Het
Obscn C T 11: 59,122,619 probably null Het
P4ha2 G A 11: 54,126,412 probably null Het
Pcdha9 T A 18: 36,999,111 V411D probably benign Het
Pkhd1l1 A T 15: 44,525,988 I1380F probably damaging Het
Plekha1 T C 7: 130,892,253 V106A probably benign Het
Plekhm1 A T 11: 103,376,691 V818E possibly damaging Het
Pprc1 T G 19: 46,065,370 probably benign Het
Prmt9 T C 8: 77,561,018 probably benign Het
Rab26 T C 17: 24,530,399 N193D possibly damaging Het
Rnf111 A G 9: 70,429,580 S942P probably damaging Het
Scgb2b18 T C 7: 33,173,225 T52A probably damaging Het
Syt3 C T 7: 44,392,763 Q349* probably null Het
Tas2r107 T C 6: 131,659,780 N102S probably benign Het
Tcaf2 A T 6: 42,642,778 I105N probably benign Het
Tet1 A C 10: 62,879,773 M81R probably benign Het
Togaram2 T C 17: 71,729,205 Y897H probably damaging Het
Trerf1 A T 17: 47,314,271 noncoding transcript Het
Ttn G A 2: 76,761,235 T12703I probably damaging Het
Unc79 A G 12: 103,125,626 K1735E possibly damaging Het
Usp54 G A 14: 20,583,351 T372I possibly damaging Het
Wdr24 T C 17: 25,827,128 S476P probably benign Het
Wdr78 G A 4: 103,049,589 P676S probably benign Het
Zbtb1 T C 12: 76,386,275 I345T possibly damaging Het
Zcrb1 T A 15: 93,395,615 I29L probably benign Het
Zfp341 T A 2: 154,630,441 C315S probably damaging Het
Zfp623 C A 15: 75,948,163 R323S probably benign Het
Zfp831 T A 2: 174,644,092 Y187N possibly damaging Het
Other mutations in Tas2r126
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Tas2r126 APN 6 42435349 missense possibly damaging 0.67
IGL01327:Tas2r126 APN 6 42434750 missense probably benign 0.09
IGL01690:Tas2r126 APN 6 42435307 missense probably benign 0.02
IGL02153:Tas2r126 APN 6 42434664 missense probably benign 0.32
IGL02291:Tas2r126 APN 6 42435287 missense probably benign 0.00
IGL03365:Tas2r126 APN 6 42435457 missense probably benign 0.36
R0091:Tas2r126 UTSW 6 42435102 missense probably benign
R0486:Tas2r126 UTSW 6 42435291 missense probably benign 0.01
R0611:Tas2r126 UTSW 6 42435091 missense probably damaging 0.99
R1527:Tas2r126 UTSW 6 42435136 missense probably benign 0.03
R1529:Tas2r126 UTSW 6 42434568 missense probably benign 0.00
R1883:Tas2r126 UTSW 6 42435027 missense probably benign
R1884:Tas2r126 UTSW 6 42435027 missense probably benign
R2039:Tas2r126 UTSW 6 42434623 missense probably benign 0.22
R4863:Tas2r126 UTSW 6 42435390 missense probably benign 0.02
R7127:Tas2r126 UTSW 6 42434805 missense probably damaging 1.00
R7351:Tas2r126 UTSW 6 42435306 missense probably benign 0.02
R7714:Tas2r126 UTSW 6 42435097 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CCGGCAGCTCATTAGTCTTC -3'
(R):5'- ATTCTTAGCGAATGCCTTCTGAG -3'

Sequencing Primer
(F):5'- ACTGGGACTTCTTGAACTCAG -3'
(R):5'- CGAATGCCTTCTGAGAGAACTGATC -3'
Posted On2017-03-31