Incidental Mutation 'R5975:Tcaf2'
ID 471677
Institutional Source Beutler Lab
Gene Symbol Tcaf2
Ensembl Gene ENSMUSG00000029851
Gene Name TRPM8 channel-associated factor 2
Synonyms Fam115c
Accession Numbers

Ncbi RefSeq: NM_146174.1; MGI:2385258

Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R5975 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 42623016-42645254 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 42642778 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 105 (I105N)
Ref Sequence ENSEMBL: ENSMUSP00000031879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031879]
AlphaFold Q921K8
Predicted Effect probably benign
Transcript: ENSMUST00000031879
AA Change: I105N

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031879
Gene: ENSMUSG00000029851
AA Change: I105N

DomainStartEndE-ValueType
low complexity region 515 526 N/A INTRINSIC
M60-like 543 842 4.85e-138 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (80/82)
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,969,221 T2233I possibly damaging Het
9430038I01Rik T C 7: 137,387,292 probably benign Het
Abhd14a A T 9: 106,443,951 probably null Het
Actn2 T C 13: 12,340,497 N2D probably benign Het
Adcy9 T C 16: 4,311,567 E722G probably damaging Het
Alox12 C A 11: 70,242,783 V572L possibly damaging Het
Ankrd11 T C 8: 122,889,749 I2434V possibly damaging Het
Anks1 T A 17: 27,991,447 probably null Het
Bpifa3 T A 2: 154,136,321 S148T probably damaging Het
Bptf C T 11: 107,035,864 probably benign Het
Cabin1 A T 10: 75,657,839 L1655H probably damaging Het
Ccdc13 G T 9: 121,827,235 Q171K probably benign Het
Ccdc33 T A 9: 58,117,478 Q155L possibly damaging Het
Cckbr G A 7: 105,470,619 G280E probably benign Het
Cdk11b G A 4: 155,648,240 probably benign Het
Celsr1 G T 15: 85,919,038 probably null Het
Cenpj A T 14: 56,564,066 I150N possibly damaging Het
Cep135 C A 5: 76,640,890 A1110E possibly damaging Het
Chit1 C A 1: 134,146,626 H224N probably damaging Het
Cul5 T C 9: 53,622,793 R680G probably damaging Het
Dhx58 C A 11: 100,702,209 R224L probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dnah5 A C 15: 28,234,282 D279A probably damaging Het
Enpp3 A G 10: 24,774,842 W799R probably benign Het
Ercc5 A G 1: 44,173,406 T675A probably benign Het
Farsa T A 8: 84,864,432 probably null Het
Fbxw15 A T 9: 109,555,252 V397D probably damaging Het
Fcrl5 G A 3: 87,442,103 V62I probably benign Het
Gart A G 16: 91,624,336 S815P probably damaging Het
Glrx5 A G 12: 105,040,323 N111S possibly damaging Het
Gm10845 A G 14: 79,863,174 noncoding transcript Het
Gm11639 A G 11: 104,687,549 probably benign Het
Gm8882 A G 6: 132,362,073 S61P unknown Het
Gm9925 T A 18: 74,065,516 probably benign Het
Gsdme T C 6: 50,227,359 N206S probably benign Het
Helz2 T C 2: 181,231,050 S2459G probably benign Het
Hnrnpul1 A G 7: 25,754,359 S93P possibly damaging Het
Ints2 A T 11: 86,226,748 I716N possibly damaging Het
Lmnb2 G A 10: 80,905,128 Q248* probably null Het
Map3k7cl A G 16: 87,570,321 I32V probably benign Het
Mfsd4b4 A T 10: 39,892,470 I255N probably benign Het
Myh6 A G 14: 54,950,508 I1163T probably benign Het
Nphs1 A T 7: 30,466,115 T636S possibly damaging Het
Ntsr1 T A 2: 180,500,788 L124Q probably damaging Het
Obscn C T 11: 59,122,619 probably null Het
P4ha2 G A 11: 54,126,412 probably null Het
Pcdha9 T A 18: 36,999,111 V411D probably benign Het
Pkhd1l1 A T 15: 44,525,988 I1380F probably damaging Het
Plekha1 T C 7: 130,892,253 V106A probably benign Het
Plekhm1 A T 11: 103,376,691 V818E possibly damaging Het
Pprc1 T G 19: 46,065,370 probably benign Het
Prmt9 T C 8: 77,561,018 probably benign Het
Rab26 T C 17: 24,530,399 N193D possibly damaging Het
Rnf111 A G 9: 70,429,580 S942P probably damaging Het
Scgb2b18 T C 7: 33,173,225 T52A probably damaging Het
Syt3 C T 7: 44,392,763 Q349* probably null Het
Tas2r107 T C 6: 131,659,780 N102S probably benign Het
Tas2r126 T A 6: 42,435,000 Y156N possibly damaging Het
Tet1 A C 10: 62,879,773 M81R probably benign Het
Togaram2 T C 17: 71,729,205 Y897H probably damaging Het
Trerf1 A T 17: 47,314,271 noncoding transcript Het
Ttn G A 2: 76,761,235 T12703I probably damaging Het
Unc79 A G 12: 103,125,626 K1735E possibly damaging Het
Usp54 G A 14: 20,583,351 T372I possibly damaging Het
Wdr24 T C 17: 25,827,128 S476P probably benign Het
Wdr78 G A 4: 103,049,589 P676S probably benign Het
Zbtb1 T C 12: 76,386,275 I345T possibly damaging Het
Zcrb1 T A 15: 93,395,615 I29L probably benign Het
Zfp341 T A 2: 154,630,441 C315S probably damaging Het
Zfp623 C A 15: 75,948,163 R323S probably benign Het
Zfp831 T A 2: 174,644,092 Y187N possibly damaging Het
Other mutations in Tcaf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Tcaf2 APN 6 42630036 nonsense probably null
IGL00909:Tcaf2 APN 6 42624576 missense probably damaging 1.00
IGL01448:Tcaf2 APN 6 42630328 missense probably benign 0.05
IGL01870:Tcaf2 APN 6 42624477 missense possibly damaging 0.47
IGL02133:Tcaf2 APN 6 42627396 missense probably benign 0.06
IGL02208:Tcaf2 APN 6 42629086 missense probably damaging 1.00
IGL02666:Tcaf2 APN 6 42629124 splice site probably benign
jiaozhi UTSW 6 42626437 missense probably damaging 1.00
PIT4260001:Tcaf2 UTSW 6 42642805 missense probably damaging 0.97
PIT4382001:Tcaf2 UTSW 6 42624366 makesense probably null
R0029:Tcaf2 UTSW 6 42630159 nonsense probably null
R0029:Tcaf2 UTSW 6 42630159 nonsense probably null
R0047:Tcaf2 UTSW 6 42629613 missense probably benign
R0047:Tcaf2 UTSW 6 42629613 missense probably benign
R0255:Tcaf2 UTSW 6 42642904 missense possibly damaging 0.95
R0617:Tcaf2 UTSW 6 42642511 missense probably damaging 0.97
R1387:Tcaf2 UTSW 6 42624578 missense probably damaging 1.00
R1523:Tcaf2 UTSW 6 42624451 nonsense probably null
R1529:Tcaf2 UTSW 6 42629506 missense probably benign 0.03
R1698:Tcaf2 UTSW 6 42628017 nonsense probably null
R1992:Tcaf2 UTSW 6 42629857 missense probably benign
R2065:Tcaf2 UTSW 6 42628047 missense probably benign 0.12
R2144:Tcaf2 UTSW 6 42642804 missense probably benign 0.45
R2435:Tcaf2 UTSW 6 42630364 missense possibly damaging 0.72
R2519:Tcaf2 UTSW 6 42629431 missense possibly damaging 0.92
R3979:Tcaf2 UTSW 6 42642547 missense probably damaging 1.00
R4093:Tcaf2 UTSW 6 42642838 missense probably damaging 1.00
R4532:Tcaf2 UTSW 6 42626437 missense probably damaging 1.00
R4780:Tcaf2 UTSW 6 42628062 missense probably damaging 1.00
R4906:Tcaf2 UTSW 6 42629745 missense probably benign 0.02
R4993:Tcaf2 UTSW 6 42642640 missense probably damaging 1.00
R5076:Tcaf2 UTSW 6 42629467 missense probably benign 0.16
R5643:Tcaf2 UTSW 6 42642773 missense possibly damaging 0.85
R5644:Tcaf2 UTSW 6 42642773 missense possibly damaging 0.85
R6234:Tcaf2 UTSW 6 42630374 missense probably benign
R6269:Tcaf2 UTSW 6 42627408 missense probably damaging 1.00
R6276:Tcaf2 UTSW 6 42629753 missense probably benign 0.04
R6375:Tcaf2 UTSW 6 42626178 missense probably damaging 0.99
R6523:Tcaf2 UTSW 6 42643019 missense probably benign 0.01
R6825:Tcaf2 UTSW 6 42629518 missense probably benign 0.05
R7039:Tcaf2 UTSW 6 42626140 missense probably damaging 1.00
R7099:Tcaf2 UTSW 6 42630341 missense probably benign 0.02
R7284:Tcaf2 UTSW 6 42629538 missense probably damaging 1.00
R7822:Tcaf2 UTSW 6 42629099 missense possibly damaging 0.95
R7964:Tcaf2 UTSW 6 42629706 missense probably benign
R8270:Tcaf2 UTSW 6 42630024 missense probably benign 0.30
R8505:Tcaf2 UTSW 6 42629541 missense probably benign 0.18
R8702:Tcaf2 UTSW 6 42642767 missense probably benign 0.11
R8788:Tcaf2 UTSW 6 42629538 missense probably damaging 1.00
R8979:Tcaf2 UTSW 6 42624470 missense probably damaging 1.00
R9374:Tcaf2 UTSW 6 42642794 missense probably benign 0.02
R9379:Tcaf2 UTSW 6 42642583 missense probably benign 0.00
Y4339:Tcaf2 UTSW 6 42629472 missense probably benign
Y4341:Tcaf2 UTSW 6 42629472 missense probably benign
Z1177:Tcaf2 UTSW 6 42629616 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAATAGCACCTTGTCACTGC -3'
(R):5'- CCTTCCCAGTGATGGTGAATG -3'

Sequencing Primer
(F):5'- TGTCACTGCCATGCTGACTGG -3'
(R):5'- CTTCCCAGTGATGGTGAATGACAAG -3'
Posted On 2017-03-31