Incidental Mutation 'R5975:Gsdme'
ID471678
Institutional Source Beutler Lab
Gene Symbol Gsdme
Ensembl Gene ENSMUSG00000029821
Gene Namegasdermin E
Synonyms4932441K13Rik, Dfna5h, Dfna5, Fin15, 2310037D07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5975 (G1)
Quality Score180
Status Validated
Chromosome6
Chromosomal Location50188888-50263862 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50227359 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 206 (N206S)
Ref Sequence ENSEMBL: ENSMUSP00000126759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031845] [ENSMUST00000101405] [ENSMUST00000165099] [ENSMUST00000170142]
Predicted Effect probably benign
Transcript: ENSMUST00000031845
AA Change: N206S

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000031845
Gene: ENSMUSG00000029821
AA Change: N206S

DomainStartEndE-ValueType
Pfam:Gasdermin 1 473 4.8e-167 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101405
AA Change: N206S

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000098952
Gene: ENSMUSG00000029821
AA Change: N206S

DomainStartEndE-ValueType
Pfam:Gasdermin 1 399 2e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165099
AA Change: N206S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000130522
Gene: ENSMUSG00000029821
AA Change: N206S

DomainStartEndE-ValueType
Pfam:Gasdermin 1 424 1.7e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170142
AA Change: N206S

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126759
Gene: ENSMUSG00000029821
AA Change: N206S

DomainStartEndE-ValueType
Pfam:Gasdermin 1 473 2.3e-149 PFAM
Meta Mutation Damage Score 0.1259 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hearing impairment is a heterogeneous condition with over 40 loci described. The protein encoded by this gene is expressed in fetal cochlea, however, its function is not known. Nonsyndromic hearing impairment is associated with a mutation in this gene. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display abnormal numbers of cochlear hair cell but have normal hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,969,221 T2233I possibly damaging Het
9430038I01Rik T C 7: 137,387,292 probably benign Het
Abhd14a A T 9: 106,443,951 probably null Het
Actn2 T C 13: 12,340,497 N2D probably benign Het
Adcy9 T C 16: 4,311,567 E722G probably damaging Het
Alox12 C A 11: 70,242,783 V572L possibly damaging Het
Ankrd11 T C 8: 122,889,749 I2434V possibly damaging Het
Anks1 T A 17: 27,991,447 probably null Het
Bpifa3 T A 2: 154,136,321 S148T probably damaging Het
Bptf C T 11: 107,035,864 probably benign Het
Cabin1 A T 10: 75,657,839 L1655H probably damaging Het
Ccdc13 G T 9: 121,827,235 Q171K probably benign Het
Ccdc33 T A 9: 58,117,478 Q155L possibly damaging Het
Cckbr G A 7: 105,470,619 G280E probably benign Het
Cdk11b G A 4: 155,648,240 probably benign Het
Celsr1 G T 15: 85,919,038 probably null Het
Cenpj A T 14: 56,564,066 I150N possibly damaging Het
Cep135 C A 5: 76,640,890 A1110E possibly damaging Het
Chit1 C A 1: 134,146,626 H224N probably damaging Het
Cul5 T C 9: 53,622,793 R680G probably damaging Het
Dhx58 C A 11: 100,702,209 R224L probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dnah5 A C 15: 28,234,282 D279A probably damaging Het
Enpp3 A G 10: 24,774,842 W799R probably benign Het
Ercc5 A G 1: 44,173,406 T675A probably benign Het
Farsa T A 8: 84,864,432 probably null Het
Fbxw15 A T 9: 109,555,252 V397D probably damaging Het
Fcrl5 G A 3: 87,442,103 V62I probably benign Het
Gart A G 16: 91,624,336 S815P probably damaging Het
Glrx5 A G 12: 105,040,323 N111S possibly damaging Het
Gm10845 A G 14: 79,863,174 noncoding transcript Het
Gm11639 A G 11: 104,687,549 probably benign Het
Gm8882 A G 6: 132,362,073 S61P unknown Het
Gm9925 T A 18: 74,065,516 probably benign Het
Helz2 T C 2: 181,231,050 S2459G probably benign Het
Hnrnpul1 A G 7: 25,754,359 S93P possibly damaging Het
Ints2 A T 11: 86,226,748 I716N possibly damaging Het
Lmnb2 G A 10: 80,905,128 Q248* probably null Het
Map3k7cl A G 16: 87,570,321 I32V probably benign Het
Mfsd4b4 A T 10: 39,892,470 I255N probably benign Het
Myh6 A G 14: 54,950,508 I1163T probably benign Het
Nphs1 A T 7: 30,466,115 T636S possibly damaging Het
Ntsr1 T A 2: 180,500,788 L124Q probably damaging Het
Obscn C T 11: 59,122,619 probably null Het
P4ha2 G A 11: 54,126,412 probably null Het
Pcdha9 T A 18: 36,999,111 V411D probably benign Het
Pkhd1l1 A T 15: 44,525,988 I1380F probably damaging Het
Plekha1 T C 7: 130,892,253 V106A probably benign Het
Plekhm1 A T 11: 103,376,691 V818E possibly damaging Het
Pprc1 T G 19: 46,065,370 probably benign Het
Prmt9 T C 8: 77,561,018 probably benign Het
Rab26 T C 17: 24,530,399 N193D possibly damaging Het
Rnf111 A G 9: 70,429,580 S942P probably damaging Het
Scgb2b18 T C 7: 33,173,225 T52A probably damaging Het
Syt3 C T 7: 44,392,763 Q349* probably null Het
Tas2r107 T C 6: 131,659,780 N102S probably benign Het
Tas2r126 T A 6: 42,435,000 Y156N possibly damaging Het
Tcaf2 A T 6: 42,642,778 I105N probably benign Het
Tet1 A C 10: 62,879,773 M81R probably benign Het
Togaram2 T C 17: 71,729,205 Y897H probably damaging Het
Trerf1 A T 17: 47,314,271 noncoding transcript Het
Ttn G A 2: 76,761,235 T12703I probably damaging Het
Unc79 A G 12: 103,125,626 K1735E possibly damaging Het
Usp54 G A 14: 20,583,351 T372I possibly damaging Het
Wdr24 T C 17: 25,827,128 S476P probably benign Het
Wdr78 G A 4: 103,049,589 P676S probably benign Het
Zbtb1 T C 12: 76,386,275 I345T possibly damaging Het
Zcrb1 T A 15: 93,395,615 I29L probably benign Het
Zfp341 T A 2: 154,630,441 C315S probably damaging Het
Zfp623 C A 15: 75,948,163 R323S probably benign Het
Zfp831 T A 2: 174,644,092 Y187N possibly damaging Het
Other mutations in Gsdme
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gsdme APN 6 50229284 critical splice donor site probably null
IGL01462:Gsdme APN 6 50227374 missense possibly damaging 0.94
IGL01645:Gsdme APN 6 50251336 missense probably damaging 1.00
IGL01836:Gsdme APN 6 50222789 missense probably damaging 1.00
R0060:Gsdme UTSW 6 50221029 missense possibly damaging 0.73
R0060:Gsdme UTSW 6 50221029 missense possibly damaging 0.73
R0110:Gsdme UTSW 6 50246127 splice site probably benign
R0396:Gsdme UTSW 6 50221107 missense probably benign 0.00
R0510:Gsdme UTSW 6 50246127 splice site probably benign
R0627:Gsdme UTSW 6 50229279 splice site probably benign
R1350:Gsdme UTSW 6 50246128 splice site probably null
R1992:Gsdme UTSW 6 50208122 missense probably damaging 1.00
R2869:Gsdme UTSW 6 50208177 nonsense probably null
R2869:Gsdme UTSW 6 50208177 nonsense probably null
R2973:Gsdme UTSW 6 50229324 missense probably damaging 1.00
R2974:Gsdme UTSW 6 50229324 missense probably damaging 1.00
R3154:Gsdme UTSW 6 50251363 missense probably damaging 0.99
R3816:Gsdme UTSW 6 50219411 missense probably benign 0.41
R3818:Gsdme UTSW 6 50219411 missense probably benign 0.41
R3819:Gsdme UTSW 6 50219411 missense probably benign 0.41
R4035:Gsdme UTSW 6 50229448 missense possibly damaging 0.50
R4519:Gsdme UTSW 6 50229353 missense probably damaging 1.00
R4669:Gsdme UTSW 6 50208122 missense probably damaging 1.00
R4678:Gsdme UTSW 6 50229324 missense possibly damaging 0.87
R5009:Gsdme UTSW 6 50246012 missense possibly damaging 0.64
R5370:Gsdme UTSW 6 50229306 missense probably damaging 0.98
R5768:Gsdme UTSW 6 50219300 nonsense probably null
R5811:Gsdme UTSW 6 50245945 missense probably benign 0.02
R6032:Gsdme UTSW 6 50245954 missense probably damaging 1.00
R6032:Gsdme UTSW 6 50245954 missense probably damaging 1.00
R6035:Gsdme UTSW 6 50229326 missense probably damaging 0.99
R6035:Gsdme UTSW 6 50229326 missense probably damaging 0.99
R6089:Gsdme UTSW 6 50251305 missense probably damaging 0.99
R6565:Gsdme UTSW 6 50229449 missense probably damaging 0.97
R6862:Gsdme UTSW 6 50227398 missense probably damaging 1.00
R7169:Gsdme UTSW 6 50227378 missense probably benign 0.00
R7720:Gsdme UTSW 6 50229308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCATGCTCAGTGACAC -3'
(R):5'- ATGCCACCCAATACTAGTGC -3'

Sequencing Primer
(F):5'- GGTGAATGAAGCCCCTGG -3'
(R):5'- CCAATACTAGTGCCAGCTGTC -3'
Posted On2017-03-31