Incidental Mutation 'R5975:Hnrnpul1'
ID 471681
Institutional Source Beutler Lab
Gene Symbol Hnrnpul1
Ensembl Gene ENSMUSG00000040725
Gene Name heterogeneous nuclear ribonucleoprotein U-like 1
Synonyms E1B-AP5, E130317O14Rik, E1BAP5, Hnrpul1, Hnrnpul
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock # R5975 (G1)
Quality Score 141
Status Validated
Chromosome 7
Chromosomal Location 25721165-25754757 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25754359 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 93 (S93P)
Ref Sequence ENSEMBL: ENSMUSP00000146263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002677] [ENSMUST00000043765] [ENSMUST00000085948] [ENSMUST00000108401] [ENSMUST00000206832]
AlphaFold Q8VDM6
Predicted Effect probably benign
Transcript: ENSMUST00000002677
SMART Domains Protein: ENSMUSP00000002677
Gene: ENSMUSG00000002602

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 35 124 5.53e-6 SMART
IG 139 218 9.06e-2 SMART
FN3 219 312 9.25e-6 SMART
FN3 328 409 2.18e-2 SMART
transmembrane domain 444 466 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
TyrKc 530 797 1.91e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043765
SMART Domains Protein: ENSMUSP00000037268
Gene: ENSMUSG00000040725

DomainStartEndE-ValueType
SAP 3 37 2.86e-10 SMART
low complexity region 62 74 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
low complexity region 201 209 N/A INTRINSIC
SPRY 255 388 8.49e-41 SMART
Pfam:AAA_33 424 569 1.4e-29 PFAM
low complexity region 613 626 N/A INTRINSIC
low complexity region 631 693 N/A INTRINSIC
low complexity region 695 718 N/A INTRINSIC
low complexity region 745 765 N/A INTRINSIC
low complexity region 768 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085948
SMART Domains Protein: ENSMUSP00000083110
Gene: ENSMUSG00000002602

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 35 124 5.53e-6 SMART
IG 139 218 9.06e-2 SMART
FN3 219 312 9.25e-6 SMART
FN3 328 409 2.18e-2 SMART
transmembrane domain 435 457 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
TyrKc 521 788 1.91e-134 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108401
AA Change: S93P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104038
Gene: ENSMUSG00000040725
AA Change: S93P

DomainStartEndE-ValueType
SAP 3 37 2.86e-10 SMART
low complexity region 62 74 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
low complexity region 201 209 N/A INTRINSIC
Pfam:SPRY 255 338 2e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000206832
AA Change: S93P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.0710 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear RNA-binding protein of the heterogeneous nuclear ribonucleoprotein (hnRNP) family. This protein binds specifically to adenovirus early-1B-55kDa oncoprotein. It may play an important role in nucleocytoplasmic RNA transport, and its function is modulated by early-1B-55kDa in adenovirus-infected cells. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,969,221 T2233I possibly damaging Het
9430038I01Rik T C 7: 137,387,292 probably benign Het
Abhd14a A T 9: 106,443,951 probably null Het
Actn2 T C 13: 12,340,497 N2D probably benign Het
Adcy9 T C 16: 4,311,567 E722G probably damaging Het
Alox12 C A 11: 70,242,783 V572L possibly damaging Het
Ankrd11 T C 8: 122,889,749 I2434V possibly damaging Het
Anks1 T A 17: 27,991,447 probably null Het
Bpifa3 T A 2: 154,136,321 S148T probably damaging Het
Bptf C T 11: 107,035,864 probably benign Het
Cabin1 A T 10: 75,657,839 L1655H probably damaging Het
Ccdc13 G T 9: 121,827,235 Q171K probably benign Het
Ccdc33 T A 9: 58,117,478 Q155L possibly damaging Het
Cckbr G A 7: 105,470,619 G280E probably benign Het
Cdk11b G A 4: 155,648,240 probably benign Het
Celsr1 G T 15: 85,919,038 probably null Het
Cenpj A T 14: 56,564,066 I150N possibly damaging Het
Cep135 C A 5: 76,640,890 A1110E possibly damaging Het
Chit1 C A 1: 134,146,626 H224N probably damaging Het
Cul5 T C 9: 53,622,793 R680G probably damaging Het
Dhx58 C A 11: 100,702,209 R224L probably damaging Het
Dlx1 C A 2: 71,531,009 N122K probably damaging Het
Dnah5 A C 15: 28,234,282 D279A probably damaging Het
Enpp3 A G 10: 24,774,842 W799R probably benign Het
Ercc5 A G 1: 44,173,406 T675A probably benign Het
Farsa T A 8: 84,864,432 probably null Het
Fbxw15 A T 9: 109,555,252 V397D probably damaging Het
Fcrl5 G A 3: 87,442,103 V62I probably benign Het
Gart A G 16: 91,624,336 S815P probably damaging Het
Glrx5 A G 12: 105,040,323 N111S possibly damaging Het
Gm10845 A G 14: 79,863,174 noncoding transcript Het
Gm11639 A G 11: 104,687,549 probably benign Het
Gm8882 A G 6: 132,362,073 S61P unknown Het
Gm9925 T A 18: 74,065,516 probably benign Het
Gsdme T C 6: 50,227,359 N206S probably benign Het
Helz2 T C 2: 181,231,050 S2459G probably benign Het
Ints2 A T 11: 86,226,748 I716N possibly damaging Het
Lmnb2 G A 10: 80,905,128 Q248* probably null Het
Map3k7cl A G 16: 87,570,321 I32V probably benign Het
Mfsd4b4 A T 10: 39,892,470 I255N probably benign Het
Myh6 A G 14: 54,950,508 I1163T probably benign Het
Nphs1 A T 7: 30,466,115 T636S possibly damaging Het
Ntsr1 T A 2: 180,500,788 L124Q probably damaging Het
Obscn C T 11: 59,122,619 probably null Het
P4ha2 G A 11: 54,126,412 probably null Het
Pcdha9 T A 18: 36,999,111 V411D probably benign Het
Pkhd1l1 A T 15: 44,525,988 I1380F probably damaging Het
Plekha1 T C 7: 130,892,253 V106A probably benign Het
Plekhm1 A T 11: 103,376,691 V818E possibly damaging Het
Pprc1 T G 19: 46,065,370 probably benign Het
Prmt9 T C 8: 77,561,018 probably benign Het
Rab26 T C 17: 24,530,399 N193D possibly damaging Het
Rnf111 A G 9: 70,429,580 S942P probably damaging Het
Scgb2b18 T C 7: 33,173,225 T52A probably damaging Het
Syt3 C T 7: 44,392,763 Q349* probably null Het
Tas2r107 T C 6: 131,659,780 N102S probably benign Het
Tas2r126 T A 6: 42,435,000 Y156N possibly damaging Het
Tcaf2 A T 6: 42,642,778 I105N probably benign Het
Tet1 A C 10: 62,879,773 M81R probably benign Het
Togaram2 T C 17: 71,729,205 Y897H probably damaging Het
Trerf1 A T 17: 47,314,271 noncoding transcript Het
Ttn G A 2: 76,761,235 T12703I probably damaging Het
Unc79 A G 12: 103,125,626 K1735E possibly damaging Het
Usp54 G A 14: 20,583,351 T372I possibly damaging Het
Wdr24 T C 17: 25,827,128 S476P probably benign Het
Wdr78 G A 4: 103,049,589 P676S probably benign Het
Zbtb1 T C 12: 76,386,275 I345T possibly damaging Het
Zcrb1 T A 15: 93,395,615 I29L probably benign Het
Zfp341 T A 2: 154,630,441 C315S probably damaging Het
Zfp623 C A 15: 75,948,163 R323S probably benign Het
Zfp831 T A 2: 174,644,092 Y187N possibly damaging Het
Other mutations in Hnrnpul1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Hnrnpul1 APN 7 25726154 missense possibly damaging 0.74
IGL01287:Hnrnpul1 APN 7 25726898 missense probably damaging 1.00
IGL01409:Hnrnpul1 APN 7 25724652 missense unknown
IGL02026:Hnrnpul1 APN 7 25745162 missense probably damaging 0.99
IGL02073:Hnrnpul1 APN 7 25722341 unclassified probably benign
IGL02474:Hnrnpul1 APN 7 25726757 missense probably benign 0.02
IGL02839:Hnrnpul1 APN 7 25733242 critical splice donor site probably null
IGL02894:Hnrnpul1 APN 7 25750904 missense possibly damaging 0.70
IGL03382:Hnrnpul1 APN 7 25750984 start codon destroyed probably null 0.53
R0011:Hnrnpul1 UTSW 7 25742915 splice site probably benign
R0525:Hnrnpul1 UTSW 7 25740883 missense possibly damaging 0.72
R0587:Hnrnpul1 UTSW 7 25745232 missense possibly damaging 0.70
R1121:Hnrnpul1 UTSW 7 25740907 missense possibly damaging 0.68
R1313:Hnrnpul1 UTSW 7 25722916 unclassified probably benign
R1313:Hnrnpul1 UTSW 7 25722916 unclassified probably benign
R1880:Hnrnpul1 UTSW 7 25733098 missense possibly damaging 0.95
R1892:Hnrnpul1 UTSW 7 25726766 missense probably benign 0.11
R2113:Hnrnpul1 UTSW 7 25733269 missense possibly damaging 0.47
R2194:Hnrnpul1 UTSW 7 25725922 critical splice donor site probably null
R2269:Hnrnpul1 UTSW 7 25750874 missense probably damaging 0.98
R2679:Hnrnpul1 UTSW 7 25726875 missense probably damaging 1.00
R3079:Hnrnpul1 UTSW 7 25733115 nonsense probably null
R3917:Hnrnpul1 UTSW 7 25726875 missense probably damaging 1.00
R4077:Hnrnpul1 UTSW 7 25726875 missense probably damaging 1.00
R4079:Hnrnpul1 UTSW 7 25726875 missense probably damaging 1.00
R4181:Hnrnpul1 UTSW 7 25726812 missense probably damaging 0.98
R4449:Hnrnpul1 UTSW 7 25722284 unclassified probably benign
R4707:Hnrnpul1 UTSW 7 25726833 missense probably damaging 1.00
R4764:Hnrnpul1 UTSW 7 25743011 missense probably benign 0.00
R5040:Hnrnpul1 UTSW 7 25742989 missense possibly damaging 0.86
R5131:Hnrnpul1 UTSW 7 25726794 missense probably benign 0.08
R5224:Hnrnpul1 UTSW 7 25745175 missense probably damaging 0.98
R5599:Hnrnpul1 UTSW 7 25754672 start gained probably benign
R7032:Hnrnpul1 UTSW 7 25750894 missense probably benign 0.11
R7195:Hnrnpul1 UTSW 7 25724778 missense unknown
R7231:Hnrnpul1 UTSW 7 25748417 nonsense probably null
R7667:Hnrnpul1 UTSW 7 25754421 missense probably damaging 0.99
R8017:Hnrnpul1 UTSW 7 25748464 missense probably benign 0.03
R8060:Hnrnpul1 UTSW 7 25748343 missense possibly damaging 0.54
R8319:Hnrnpul1 UTSW 7 25754477 missense probably benign
R8356:Hnrnpul1 UTSW 7 25722822 unclassified probably benign
Z1176:Hnrnpul1 UTSW 7 25724664 missense probably benign 0.23
Z1176:Hnrnpul1 UTSW 7 25724698 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGCCGCAGATCCTTTACAAC -3'
(R):5'- CCTGACAGGCAAGGTTTAGG -3'

Sequencing Primer
(F):5'- ATCCTTTACAACGGCAGGTG -3'
(R):5'- GCCTGAAGGTGAACGAACTTC -3'
Posted On 2017-03-31